1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
torisob [31]
3 years ago
7

Some human traits are controlled by more than two alleles this is called

Biology
1 answer:
VikaD [51]3 years ago
7 0
Human traits controlled by multiple alleles are called multiple-allele traits. One widely known example is ABO blood type, which is controlled by 3 alleles.
You might be interested in
About haw many chloroplasts can be found in photosynthetic cells
trasher [3.6K]
The answer is thousands, thousands of chloroplasts can be found in the photosynthetic cells.
4 0
3 years ago
Which of the following is a relatively new disease? A. polio B. bird flu C. small pox D. tuberculosis
andre [41]
The answer is B, bird flu. The other diseases have been around much longer than bird flu has. Bird flu has been in Asia since 2003, but didn't reach Europe and the middle east until 2005, making bird flu a very new disease.

5 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
A mutation near the middle of a gene changes the DNA to the following nucleotides: ATT. What
True [87]

Answer:

A mutation near the middle of a gene changes the DNA to the following nucleotides: ATT. What  kind of mutation occurred in this situation?

missense mutation

Explanation:

3 0
3 years ago
Water then changes into clouds through the process of ____________________ and falls to the ground as precipitation (rain, hail,
sp2606 [1]

Answer:

Precipitation condenses

5 0
3 years ago
Other questions:
  • What is the meaning of sound waves
    7·1 answer
  • The movement of water through a plant is caused, in part, by
    10·1 answer
  • Which factor does not affect a habitat's carrying capacity?
    13·1 answer
  • What is a high speed, high altitude wind that moves air masses?
    14·1 answer
  • There are many ways to drink water throughout the day. Which method has the least harmful impact on the environment?
    6·2 answers
  • What is the possible consequence of melting glaciers on polar bears
    14·1 answer
  • Clinical trials occur under very specialized, controlled conditions that do not represent everyday life. generalizing the result
    7·1 answer
  • Shortly after adopting his cat, Sassy, Thomas realizes that his poor cat isn’t eating very much. After ruling out any illnesses,
    9·1 answer
  • What is the term for a membrane-enclosed structure within a cell that performs a specific function?
    14·2 answers
  • DNA structure diagram
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!