Why did the petri dish get warm when hydrogen peroxide and liver were combined?

Biology

1 answer:

maks197457 [2]3 years ago

7 0

Answer: The bubbles will form due to the liberation of oxygen gas and white spots will develop on the liver.

Explanation:

The liver is a vital organ, its function is to metabolize the toxins into less harmful metabolites, that are excreted out of the body.

The catalase is one of the enzymes that participate in the metabolic activities of the liver. In the given condition, when hydrogen peroxide and liver were combined. The catalase enzyme breaks down the hydrogen peroxide into water and oxygen. In this reaction, the oxygen gas is liberated, in the form of bubbles and this reaction produces white colored foam which later leaves white spots on the liver.

You might be interested in

What stage of cellular respiration produces the most ATP? (2 points)

White raven [17]

Electron transport chain <span>produces the most ATP</span>

6 0

3 years ago

Read 2 more answers

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0

4 years ago

Examine the chart shown below. genotype phenotype BB black fur Bb black fur bb brown fur What does the phenotype represent?

timama [110]

Do you have the picture of the chart?

3 0

3 years ago

Shortly after ingesting a big plate of carbohydrate-rich pasta, you measure your blood's hormone levels. What results would you

Kaylis [27]

Answer:

blood hormone level will increase

Explanation:

since once food reach the stomach it will trigger different hormone process that cause release of enzymes required to digest carbohydrate

7 0

3 years ago

Quizlet A 50-year-old female became infected with Clostridium bacteria and died a week later. Examination of her red blood cells

aleksandrvk [35]

Answer:

Clostridium tetani

Explanation:

Clostridium tetani causes tetanus, a disease that classically follows injury to the body. Clostridium tetani spores, which are commonly in soil and animal faeces are deposited in the wound and germinate in anaerobic condition. It releases toxins which are tetanospasmin and tetanolysin. Tetanospasmin is responsible for sustained contraction while tetanolysin is responsible for hemolysis of blood cells which is commonly associated with clostridium tetani.

4 0

3 years ago