1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sesenic [268]
2 years ago
12

What are the more primitive of the two types of cells.​

Biology
1 answer:
Free_Kalibri [48]2 years ago
8 0
Prokaryotic And Eukaryotic :)
You might be interested in
Why can the wolf be considered both a seconday consumer and a tertiary consumer??
xeze [42]
Because it can eat primary consumers and secondary consumers both. Veggie eaters and meat eaters
3 0
3 years ago
Craig recently passed away from a cancer that started in his bone marrow. what type of cancer caused craig's death?
____ [38]
Typical bone cancer I believe
7 0
3 years ago
Read 2 more answers
Total magnification of a specimen under the scanning objective is:
umka21 [38]
C is the answer to your problem
8 0
3 years ago
Can someone please check if my answers are right for questions 34 and 35. Thanks!!
antoniya [11.8K]

Answer:

yes the answer are actually very correct

7 0
2 years ago
Read 2 more answers
What should be done to correct positioning on an anteroposterior (AP) elbow with lateral rotation, when the radial head is sligh
natka813 [3]
<h2>Functions of elbow joint </h2>

Explanation:

  • The elbow joint should be rotated laterally.
  • This is because the elbow is basically a pivoted joint, however, it has the extraordinary capacity to turn the distal arm in pronation and supination
  • These exceptional movements, alongside a wide scope of dynamic exertional powers, incline the elbow and its structures to critical wounds, especially with tedious movements
  • Understanding the life systems and the physical powers of development will help in diagnosis
  • Hence, the right answer is "elbow joint should be rotated laterally on an (AP), when the radial head is slightly superimposed over the proximal ulna on the first effort"

8 0
3 years ago
Other questions:
  • Do you think flowchart is the best way to explain how the nervous system works to someone who's unfamiliar with the concept? Exp
    8·1 answer
  • House sparrows from England were released in the United States. They have competed with native bluebirds. These house sparrows a
    9·1 answer
  • Why does your body need more water when you are very active?
    12·1 answer
  • What are the three major types of rocks
    10·1 answer
  • What is the most important role of hydrogen bonding between water molecules?
    7·1 answer
  • What is homozygous?
    14·1 answer
  • Explain the concept of natural selection.
    10·1 answer
  • Which type of star system has the most stars?
    12·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • How are gasses exchanged in the alveoli
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!