1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ioda
3 years ago
7

Physical and chemical changes occur during digestion. An example of a chemical

Biology
1 answer:
Fofino [41]3 years ago
8 0

Explanation:

enzyme breaking food down because their is are juice in the stomach and also in the intestines

You might be interested in
What is molecular biology​
Ratling [72]

Explanation:

Molecular biology is a branch of biology that concerns the molecular basis of biological activity between biomolecules in the various systems of a cell, including the interactions between DNA, RNA, proteins and their biosynthesis, as well as the regulation of these interactions.

6 0
3 years ago
Which epithelial tissue is shaped like a column?
Vsevolod [243]

Answer:

D. Columnar

Explanation:

Hint the root word is in the option and it is actually shaped like a column according to Epithelium - Wikipedia

Hope this helps : )

3 0
3 years ago
Which would be an example of disruptive natural selection?
expeople1 [14]

An example of disruptive natural selection is the presence of more light-colored moths in rural areas and to more dark-colored moths in industrial areas but FEWER medium-colored moths in either location. Thus, the correct option is A.

<h3>What do you mean by Natural selection?</h3>

Natural selection may be defined as the approach through which populations of living organisms acclimate and change.

Disruptive natural selection occurs when environmental conditions changes in two different ways or in two different locations.

Therefore, the correct option for this question is A.

To learn more about Natural selection, refer to the link:

brainly.com/question/14385908

#SPJ1

5 0
2 years ago
A virus particle will never contain:-
charle [14.2K]

Answer:

Viruses are smaller and simpler in construction than unicellular microorganisms, and they contain only one type of nucleic acid—either DNA or RNA—never both.

Explanation:

8 0
2 years ago
Read 2 more answers
A student says that all pure substances are elements. Do you agree? Why or why not? Question 14 options: I agree. Pure substance
timurjin [86]

yes i m agree with that Pure substances include only single atoms made of one element.

in chemistry , a pure substance that has only one kind of atom and cannot be broken into two or more simpler substance by physical or chemical means is an element . for ex. gold , silver , iron etc

5 0
3 years ago
Read 2 more answers
Other questions:
  • Using at least three sentences, explain the cycling of energy through the processes of photosynthesis and cellular respiration.
    14·1 answer
  • What is a rule describing a pattern in nature called
    15·2 answers
  • A 19-year-old woman has painful ulcers on the labial mucosa and buccal mucosa of 4 days duration. she has had similar ulcers on
    13·2 answers
  • What is another name for the circulatory system
    10·2 answers
  • What are the two types of fermentation? How do the products differ?
    9·2 answers
  • 01. Why are the birds discussed in this lab called Darwin's finches?​
    9·1 answer
  • Although there is an overpopulation problem with white-tailed deer in the Southeastern United States, hunting is regulated. Why
    14·1 answer
  • At what stage of mitosis does the amount of genetic material in each chromosome become half of what it just was?
    11·2 answers
  • Describe the properties of carbon that lead to wide variation in organic compounds
    7·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!