1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natulia [17]
3 years ago
13

If a consumer version of the gene database was created, what additional features would it need to be user-friendly?

Biology
1 answer:
wolverine [178]3 years ago
8 0

Answer:

Consumer version of the gene database is defined as the public database which provides access to their genetic information to the people without involvement of healthcare provider or other services.

GenBank is an open access sequence database which is regulated by  National Center for Biotechnology Information (NCBI) that collects all the information about nucleotide sequences and their protein translation of public.

Some additional features required to make Consumer version of the gene database  user-friendly are:

  • The access of these databases should have more safety measures and privacy should be maintained.
  • Number of references sequences should increase as databases potentially contain high-quality filtered sequence data.
  • Data redundancy should be maintained .

You might be interested in
Which of the following most likely results in a decrease in a blackbird population
dexar [7]
Bright colors such as flowers or light green bushes/trees would result in an decrease in a blackbirds population because the blackbird wouldn't be able to blend into its environment due to the dark color it has, allowing many predators to spot it. So brighter colored environments would result in the decrease of the blackbird population.
3 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What do you need to know to become an astronaut?
hodyreva [135]
Smartness , good stamina ,u need a degree, experience ,and train 
5 0
3 years ago
Do you think a solar furnace could work well where you live?
swat32
<h3>Answer:</h3>

i thank we could use one

Explanation:because we don't really have cold weather in okc

hope it helps ☺

7 0
3 years ago
Genetic diversity is ultimately/mainly the result of _______________
RUDIKE [14]

Answer:

A. meiosis.

Explanation:

Meiosis is one of the two major types of cell divisions in living organisms. Meiosis is the process by which four daughter cells that are genetically different from the parent cell are produced. Meiotic process is carried out solely during sexual reproduction to yield gametes or sex cells.

The gametes have their chromosomal number reduced by half during the process. However, one immense importance of meiosis is that it PROMOTES GENETIC DIVERSITY. A process called crossing over, which is the exchange of chromosomal segment between non sister chromatids, makes this possible.

7 0
3 years ago
Other questions:
  • What part of the brain is highlighted in the diagram below? Image is highlighting the section at the rear of the brain, found at
    11·2 answers
  • Which of the choices below describes the ANS?
    15·1 answer
  • Cholesterol is an important component of animal cell membranes. Cholesterol molecules are often delivered to body cells by the b
    14·2 answers
  • Describe the relationship between DNA, chromosomes, and genes.
    7·2 answers
  • what are some limitations of modeling the flow of energy and matter in an ecosystem with a food chain?
    8·1 answer
  • What color of light corresponds to the lowest amount of light absorbed?
    10·1 answer
  • Which characteristics is common of developing countries?
    15·1 answer
  • 100 points, brainliest, and free points if you answer all correctly
    10·2 answers
  • Suppose Stephen breeds flowers and wants to optimize production of offspring with both short stems and white flowers, which are
    8·1 answer
  • What is the smallest part of an element that has the same properties of that element?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!