1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yakvenalex [24]
2 years ago
13

Sand on a beach is being continually washed farther down the shore. People who live near the beach want to stop this erosion. Wh

ich of the following structures or methods designed to deter erosion would best solve the problem?
A. groin
B. seawall
C. breakwater
D. replenishment
Biology
1 answer:
sergij07 [2.7K]2 years ago
7 0

Answer:

The Answer is Letter A.

Explanation:

let residents build groins

You might be interested in
How are your coping mechanisms for feeling stressed<br> related to cellular homeostasis?
Viefleur [7K]

When a cell has too much of one thing, homeostasis gets rid of some of it and balances the cell out. Just like when you have too much stress, you find ways (coping mechanisms) to get rid of some of it.

Explanation:

Hope this helps!

7 0
3 years ago
In a reproducing cell , the dna is found in the structures known as
UkoKoshka [18]
Answer: 2. Chromosomes
7 0
3 years ago
Read 2 more answers
Electrolytes such as sodium and potassium control blank by helping to maintain acid-base balance
yKpoI14uk [10]

Answer:

Electrolytes are nothing but minerals that have electric charge when it is mixed in liquid like blood. thus the sodium and potassium electrolytes will help regulate the nerve and muscle function. They also maintain the acid-base balance by regulating the electric charge on the cells and water flow across the membrane.

Explanation:

6 0
3 years ago
Read 2 more answers
This structure gives a cell shape, allows it to move, and moves organelles. 5 points a) cytosol b) cytoskeleton c) cytoplasm d)
MatroZZZ [7]

Answer:

B) cytoskeleton

Explanation:

the cytoskeleton is a network of connected filaments and tubules.

7 0
3 years ago
Is an atom matter? Explain
Korvikt [17]

Answer:

It´s a particle of matter. So, yeah kinda lol

Explanation:

atom, smallest unit into which matter can be divided without the release of electrically charged particles. It also is the smallest unit of matter that has the characteristic properties of a chemical element. As such, the atom is the basic building block of chemistry.

An atom is a particle of matter that uniquely defines achemical element. An atom consists of a central nucleus that is usually surrounded by one or more electrons.

3 0
2 years ago
Other questions:
  • What is the igneous rock
    14·2 answers
  • What is the oldest form of biotechnology? selective breeding hybridization cloning recombinant DNA
    6·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Trophic pyramids demonstrate the "10 percent rule of ecological efficiency. applying this concept to sustainability, at which le
    6·1 answer
  • Which statement below best summarizes the
    9·1 answer
  • Which mineral is stored in the bones and constantly being removed to maintain necessary blood levels?
    9·1 answer
  • 17. What two headed muscle comes together with the soleus to attach to the heel?
    13·1 answer
  • What is a qualitative observation?
    10·2 answers
  • Tmp/smx has two components that act on different steps in the folic acid biosynthesis pathway and are thus used together. sulfam
    15·1 answer
  • What ones of the ecological levels of organization deal with<br> just biotic factors.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!