1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yakvenalex [24]
3 years ago
13

Sand on a beach is being continually washed farther down the shore. People who live near the beach want to stop this erosion. Wh

ich of the following structures or methods designed to deter erosion would best solve the problem?
A. groin
B. seawall
C. breakwater
D. replenishment
Biology
1 answer:
sergij07 [2.7K]3 years ago
7 0

Answer:

The Answer is Letter A.

Explanation:

let residents build groins

You might be interested in
1. Identify what type of rock belongs in #2
riadik2000 [5.3K]

Answer:

1. the answer is sedimentary

2. The answer is lgneous

3. The answer is lgneous

Explanation:

4 0
2 years ago
According to model 1, what are the reactants of cellular respiration?
Crazy boy [7]
<span>Glucose —- pyruvate — acetyl-CoA — carbon dioxide Glucose is oxidized during <span>respiration.

I hope this helps.
</span></span>
6 0
3 years ago
What are the primary components of panera bread's value chain?
vfiekz [6]

The value chain, Panera Bread's value chain has several component to its value chain, customer service, operating performance, and most important being inbound logistics. The most important for Panera Bread is the Priority on inbound logistics, as it is what differentiates their product from their competitors, which is their most important competitive advantage.
6 0
3 years ago
The axial skeleton provides an extensive surface area for the attachment of muscles that __________.
garik1379 [7]

The question is incomplete as it does not have the options which are:

  • Adjusts the positions of the head, the neck, and the trunk
  • Perform respiratory movements
  • Stabilize or position parts of the appendicular skeleton
  • All of the above

Answer:

All of the above

Explanation:

The axial skeleton is the group of bones which forms the centre of the skeletal system. The central portion of the skeletal system includes bones of the skull, bones associated with the skull, the thorax, and the vertebral column (spinal cord).

There are 80 axial skeletal bones out of which 22 bones are present in the skull, 7 attached to the skull, 25 in a thoracic cage and 26 in the vertebral column.

The axial skeleton help maintains the position of the appendicular skeleton, maintain the posture of the body by maintaining the posture of the neck, head and trunk and also help in the respiratory movements.

Thus, all of the above is correct.

5 0
3 years ago
Science is best known for
andreyandreev [35.5K]

Science is best known for logics.

Science is so interesting such that it method of processing and validating logics and facts with verifiable hypothesis and experimental evidence.

This scientific method is also an empirical method of acquiring knowledge which simply involves making observation, establishing hypothesis, designing experiment, analysing result and drawing conclusions.

A hypothesis is a reasonable explanation for a particular observed natural phenomena.

<h3>What is science?</h3>

Science can simply be defined as the intellectual and practical activity encompassing the systematic study of the structure and behaviour of the physical and natural world through observation and experiment.

So therefore, science is best known for logics

Learn more about science:

brainly.com/question/17216882

#SPJ1

8 0
2 years ago
Other questions:
  • An automatic response to a stimulus is called a reflex. <br> a. True <br> b. False answers
    9·2 answers
  • A model organism is a species that researchers study to better understand certain biological processes. Mollusks and arthropods
    6·2 answers
  • Lodgepole pines, often found in the taiga, have an interesting adaptation for reproduction. These trees produce female cones tha
    11·1 answer
  • Whats the most abundant element in the atmosphere?
    11·1 answer
  • How do you determine the amount of electrons and protons?
    6·2 answers
  • Pelvic bones in whales are an example of <br> structures.
    6·2 answers
  • Some illnesses and harmful infections are caused by bacteria. These bacteria grow in the human body and often make people sick w
    6·2 answers
  • Photosynthesis is composed of two main parts (light-dependent and light independent)these reaction occur in different structures
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 2. The accompanying graph shows the
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!