1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arsen [322]
3 years ago
13

Explain the purpose of the F1 offspring. The first one to answer correctly gets a thanks and gets marked brainliest.

Biology
1 answer:
Zigmanuir [339]3 years ago
3 0
The purpose and what F1 offspring is that F1 is first filial generation produced by the offspring of set of parents. Purpose is you can cross-breed with F1 with different generations and still has F1 Generation as dominant because it has dominant genes within with depending of what your cross-breeding. Furthermore you can use the punnett square to see what the outcome accurately in percentage.
You might be interested in
A single strand of DNA helix consists of 100 nitrogenous base pairs. If 36 of the bases are adenine and 24 are cytosine, how man
Scorpion4ik [409]
If adenine and thymine are complimentary pairs, and we're finding how many thymine there should be in the case that there are 36 adenine bases, there would be 36 thymine bases.
8 0
3 years ago
Scientific root words
Firlakuza [10]

Hi there! I'd like to help but I need more information about your question.

4 0
3 years ago
Which of the following is natural gas used for in the United States?
Luden [163]
The answer is C for the this question.
7 0
3 years ago
Read 2 more answers
This type of selection operates if individuals within a population with the smallest and largest body sizes have fewer offspring
Gekata [30.6K]
<span>Stabilizing selection operates when individuals within a population of average body size have more offspring than those of large or small body size. this is the worlds way of stabilizing the population to a safe average.</span>
3 0
3 years ago
Kelp can be described as . a. slow growing aquatic plants. . b. slow growing algae . c. fast growing fungi . d. fast growing alg
romanna [79]
Kelp can be described as <span>fast growing algae. The correct option among all the options that are given in the question is the fourth option or option "d". It is a unique kind of an algae that has the capability to grow 2 feet in a day under right conditions. I hope that this is the answer that has come to your great help.</span>
4 0
3 years ago
Other questions:
  • Which of the following cells would not have a well–defined nucleus but would have a thick cell wall and Ribosomes?
    9·1 answer
  • BRAINLIST OPPORTUNITY
    14·2 answers
  • explain the how protein contained in seeds or milk is useful for the plant sprouting from the seed or the baby mammal
    10·2 answers
  • Humans often selectively breed plants to create better, more nutritious crops. Plants are not as difficult to selectively breed
    14·2 answers
  • Examine the results of an experiment above discussing how temperature affects cellular respiration.
    9·2 answers
  • What does the science root word "synthesis" mean?
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • QUESTION 1<br> Which of the following is a Neandertal trait?
    11·1 answer
  • 5. Viruses are not cells, nor are they made of cells. They also cannot
    5·1 answer
  • 3. What happens as a population approaches carrying capacity?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!