1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
3 years ago
9

It has been estimated that 99% of the intestinal bacteria are A. facultative anaerobes.B. obligate aerobes.C. facultative aerobe

s.D. obligate anaerobes.
Biology
1 answer:
Klio2033 [76]3 years ago
4 0

Answer:

Obligate anaerobes. (Ans. D)

Explanation:

Anaerobes: They are micro-organisms that do not require energy oxygen for metabolism. They can only survive in an environment that lacks oxygen.

Obligate anaerobes are bacteria typically living in various places naturally. Many of obligate anaerobes living in the human body, in places such as the mouth and gastrointestinal tract (most of the obligate anaerobes present their) where oxygen level present in very low concentration.

Obligate anaerobes do not contain several enzymes needed to detoxifying oxygen present in the cell. Oxygen produces several byproducts in the presence of water such as hydrogen peroxide, it is a week acid and affects no. of enzymes present in anaerobic cells. In a high level of oxygen anaerobic cells become more acidic and not able to function.

So that's why they are found in no oxygen or low oxygen environment like the gastrointestinal tract.  

You might be interested in
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
A stable physical mixture of two or more substances is a(n):
mixer [17]
The answer is a solution
3 0
3 years ago
Read 2 more answers
An male animal has a genotype of AaBB. The number of different gene combinations that would be found in the sex cells/sperm of t
kvv77 [185]

Answer:

B

Explanation:

Using a Punnett Square, you find that the outcomes are AB, AB, aB, and aB. There are only two unique genotypes here, so the answer is 2.

8 0
3 years ago
Where in the plant cell do the light reactions and dark reactions occur, respectively?
Ivan
This is a difficult answer because the way you worded it but I believe I understand. The answer is chloroplast. They absorb light to help feed a plant cell.

3 0
3 years ago
Sally has collected a sample of dirt from a riverbank and wants to analyze it. First she decides to find the mass of the sample.
madam [21]

Answer:

By using s measuring cylinder

6 0
3 years ago
Other questions:
  • Do prokaryote And eukaryotes and viruses have liquid cytoplasm
    10·1 answer
  • What is exocytosis and endocytosis? Think about what the words sound like.
    9·1 answer
  • Two proteins bind to the same ligand, and protein A has half of its binding sites occupied when the ligand concentration is 0.5
    11·1 answer
  • In the late 1800s, a researcher by the name of Robert Koch developed a series of postulates (guidelines) that can be used to pro
    12·1 answer
  • Which pair of organisms is most closely related to primates?
    6·1 answer
  • Which type of biological macromolecule depends most upon its three-dimensional shape to function properly?
    14·1 answer
  • . Human muscle cells compared to blood cells all contain the same number of
    5·2 answers
  • Which stage of the SoulCycle involves the division of cells nucleus?
    14·1 answer
  • And astronomer uses a telescope to observe a star. She observes that the color of the star is similar to the color of the sun. T
    11·2 answers
  • Fluid tends to be forced out of a capillary bed by ________ while ________ tends to draw fluid into the capillary bed. *
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!