1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin2010 [14]
3 years ago
9

A tube called the what extends from the bladder to the outside of the body

Biology
1 answer:
aivan3 [116]3 years ago
6 0
It is called uretra.
You might be interested in
How do the structures in an organism relate to their functions?
Volgvan
The structure<span> and </span>function relate<span> because what the </span>structure<span> is made of influences what the ... Therefore, it is fit to </span>do<span> the job of pumping blood around the body.</span>
6 0
3 years ago
He w does your nervous system work?
UkoKoshka [18]
The nervous system<span> is like a  highway along which </span>your <span>brain sends and receives information about what is happening in the body and around it. This highway is made up of billions of nerve cells, or neurons (say new-rons) which join together to make </span>nerves<span>. A nerve is a fibre that sends impulses through the body.</span>
8 0
3 years ago
Choose all the answers that apply.
Maurinko [17]

Answer:

is made of cellulose

Explanation:

omly plant cells have it

3 0
3 years ago
Read 2 more answers
A population of mice has black or brown hair. The gene for black hair color (B) is dominant over brown (b). If 16% of the mice a
astraxan [27]
If B and b are the two alleles , B + b = 1 and B ^2 +2 Bb + b ^2 = 1.

If 16% of mice are homozygous black , B ^ 2 =0 .16, meaning B = 0 .4 and b = 1 - 0. 4 = 0 .6 .
Answer = Notice how you don't even need to know that 24% of the mice are heterozygous .
6 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • Please can you guys answer all these questions​
    14·2 answers
  • Which is an example of codominance?
    14·2 answers
  • According to cell theory,
    11·2 answers
  • Which is not true about cancer cells
    6·2 answers
  • Every place on earth receives the same number of hours of sunlight each year — an average of 12 hours per day. However, the amou
    14·1 answer
  • ?hormones that cause increased activity in the ovaries and testes are known as
    6·1 answer
  • Did your school decreased their Thanksgiving break from Wed. to Sun. because of the coronavirus?
    6·2 answers
  • Which is the definition of adhesion?
    8·1 answer
  • Beauty girls can join in googl e<br>link is here<br>vit-jcnt-cqd​
    14·1 answer
  • Why cant you keep your tongue still?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!