1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRissso [65]
3 years ago
7

If the DNA sequence reads TAT, what is the mRNA codon?

Biology
1 answer:
insens350 [35]3 years ago
4 0
The complement of the DNA is ATA, but in mRNA Thymene is replaced by Uracil so it will be AUA.
You might be interested in
ASAP Help Please!! Why is bread soft and airy?
Shkiper50 [21]

Answer:

Yeast is secreting CO2 causing bubbles in the dough

Explanation:

4 0
3 years ago
Read 2 more answers
Eukaryotic cells that are destined to divide progress through G1, S, G2, and M phases, which are collectively known as the
julia-pushkina [17]

didnt understand the question, but the answer i think would be

The eukariotic cell cycle

3 0
2 years ago
NEED ANSWER ASAP
Alchen [17]
Option B: larger and more complex
4 0
3 years ago
Read 2 more answers
The scientist Jean Baptiste Lamarck proposed that if an individual acquired a particular characteristic - such as strength from
rosijanka [135]

Answer:

The idea of pangenesis

8 0
4 years ago
In which cell would you find the most lysosomes?
Anna35 [415]
I think it would be in your white blood cells
6 0
4 years ago
Other questions:
  • Lila is using a Bunsen burner. She has all of her chemicals on her workstation. Which would be the best lab practice?
    9·2 answers
  • What evidence supports the assumption that a large number of living species disappeared about 65 million years ago due to a cata
    15·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Plants need bacteria in order to take up and use which element?
    12·1 answer
  • All of the following adaptations are evolutionary
    11·1 answer
  • The size of one copy of the human genome is approximately 3 billion base pairs, and it contains about 25,000 genes organized int
    7·1 answer
  • Culture consists of the ___________________.
    8·2 answers
  • How much of the solar energy that enters the Earth's atmosphere actually reaches the earths surface
    10·1 answer
  • Study the food web above. The proliferation of which organism would MOST negatively affect food production for
    10·2 answers
  • Dna codes for a protein by?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!