During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
As an alternative to managing stressors, many organizations teach employees to use relaxation techniques to counteract the effects of stressors by engaging in activities that slow the heart rate, breathing rate, and blood pressure.
this helps the employees to get distress and they can continue their work while having being healthy both physically and mentally.
Explanation:
there are some evidence-based tools that can help to combat the negative effects of stress in healthy ways such as :-
- Getting physical- exercise, yoga can release stress
- sleep- a good seep works as an anti-stressor.
- Meditate- it is a way to motivate and relax our mind in a positive note.
- Relax your muscles- yoga and some trained techniques can do this.
- good nutrition- being healthy is the only way to br positive and distressed.
- Cultivate social support
- Try to eliminate the stressors- this is very important to be healthy and positive.
This is the answer hope it helps, have a good day
Ovulation
That's when the egg "splits" from the oviduct
Answer:
ADA is an enzyme that is used to breakdown the food chain.
Explanation:
ADA is also called adenosine deaminase. It is an enzyme. It is a purine metabolism. ADA is used to needed for the breakdown of the adenosine from the food chain. ADA is found in both small and large form. The enzyme presented in it has polypeptide chain. It is folded in eight strands.
The ADA contain zinc. It is found in deepest site and combined with five form such as 15, 17, 214, 295 and the substrate.
The ADA is is inversible dominates the adenosine. It is considered the key enzyme of the purine metabolism. ADA in human beings work for development and maintenance.