1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Daniel [21]
3 years ago
9

What was the difference between Darwin and Lamarck? A. The idea of mutations was understood by both, but Lamarck was able to pro

ve it. B. Lamarck was able to explain evolution with evidence, something Darwin did not do. C. Darwin was able to explain evolution with evidence, something Lamarck did not do. D. The idea of mutations was understood by both, but Darwin was able to prove it. I know it is definetly not b and c because they both had that in common
Biology
2 answers:
sweet-ann [11.9K]3 years ago
7 0
The main difference between Darwin and Lamarck was that "<span>D. The idea of mutations was understood by both, but Darwin was able to prove it" although this is a lot like answer C...</span>
Alika [10]3 years ago
3 0
The opposition between Darwin and Lamarck is D) <span> The idea of mutations was understood by both, but Darwin was able to prove it.</span>
You might be interested in
Which piece of children's playground equipment could be used to model and explain the movement of matter in the biosphere?
Lunna [17]
None because they are children play toys not scientific tools!
<span />
3 0
4 years ago
Which would prevent a plant from growing?
Ber [7]

Answer:

D. Sunlight

Explanation:

Since photosynthesis provides the energy the plant needs for growth, lack of light will stunt the plant's growth.

8 0
4 years ago
The use of total global resources by humans is measured in ____________.
ra1l [238]
Hectares of land used per person
3 0
3 years ago
Read 2 more answers
Which of these organelles is NOT in animal cells?
Amanda [17]

Explanation:

Cell wall is not present in animal cells .

6 0
3 years ago
Read 2 more answers
Heavenly bodies that travel around a planet are called satellites or moon which planet has no satellite or moon
IceJOKER [234]

Answer:

i think its A. i dunno if it is btw have a nice day

8 0
3 years ago
Read 2 more answers
Other questions:
  • DNA replication involves producing new copies of DNA molecules. How many individual DNA strands exist after one molecule of DNA
    10·1 answer
  • When the cell begins to synthesize genetic material, it is in _____.
    8·2 answers
  • A biologically based addiction is a condition in which
    13·1 answer
  • If the dna double helix in salmon contains 22% guanine, what is the percent of cytosine, thymine and adenine? express your answe
    8·1 answer
  • At age 4, James underwent a biopsy of the right gastrocnemius muscle. The pathologist's report noted histopathologic changes sug
    12·1 answer
  • Explain how the ratio of elements in a compound is related to the compound’s properties.
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Along with having smooth edges and lacking organelles, red blood cells are also specialized to have a concave shape. How does th
    5·1 answer
  • Formulez des hypothèses sur le mode de contamination d'un individu et citez au moins deux conseils pour prévenir la contaminatio
    8·1 answer
  • Why is it important that a protein keeps its shape?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!