1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
3 years ago
15

How are the codes (chemical formulas) for elements different than those for compounds?

Biology
1 answer:
atroni [7]3 years ago
4 0

Two or more atoms held together with bonds make up a molecule. Pure substances are made of only one type of atom. At least two types of atoms are required to make a compound. Mixtures can be made of two elements, two compounds, or an element & a compound.

You might be interested in
A laboratory procedure calls for heating 50 milliliters of a sugar of a sugar solution to 60°C. Which piece of laboratory equipm
Rina8888 [55]
A ruler will not be needed due to having a graduated cylinder which can help measure the volume of liquids
4 0
3 years ago
What is the most important factor in explaining why osmosis occurs spontaneously?
Burka [1]
Because in episode 6 of twilight Bella needed Edward and he left her in the woods
4 0
1 year ago
A weather map shows two cities along the same isobar. What does this indicate about the cities?
GalinKa [24]

Answer:

a. it is raining in both cities

Explanation:

7 0
4 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
During photosynthesis, plants use sunlight, water and ________ to create sugars then and release _________.
Kaylis [27]
Use carbon dioxide and release oxygen gas
7 0
3 years ago
Other questions:
  • How many amino acids would be encoded in the sequence 5′ AUGUUACGGAAU 3′ by a non-overlapping and maximally overlapping code?
    7·1 answer
  • Can Adaptations can be detrimental to the survival of a species.
    15·1 answer
  • for the freckles trait, having freckles (F) is dominant while no freckles (f) is recessive. What will someone that is Ff look li
    12·1 answer
  • Increased carbon in the oceans has caused the pH levels of the water to decrease. What is the largest impact of this ocean acidi
    6·2 answers
  • What is the role of scientific research in solving human health problems
    9·1 answer
  • Which organism is a primary consumer in the food web below?
    5·2 answers
  • Why must you include the water soluble vitamins in your daily diet?
    14·1 answer
  • Jerome and Frank both have genetic disorders. Jerome experiences weak muscles and Frank often loses his memory. Which most likel
    6·2 answers
  • Snapdragon color is an incomplete dominant trait. A red flower (RR) is crossed with white flower (ww). What color are the flower
    13·1 answer
  • Acquired specific immunity involves the response of:_______
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!