You can learn their traits such as the color of the feathers and where they came from or originated from
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
<span>The two scientists, who are credited with creating the first accurate model of DNA are JAMES WATSON and FRANCIS CRICK. The success that these two scientists achieved concerning DNA structure is based on the works of other scientists, who have carried out series of research on DNA. The real proof of Watson - Crick model for DNA was released in 1982, this was after the B form of DNA was crystallized and its X ray pattern was solved.</span>
Compound microscope
<h3>
Further explanation</h3>
In 1665, Robert Hooke used a compound microscope to observe cells. Hooke observes the cell walls of dead plants (in the form of cork) when they appear under a microscope. He named it the cell because it looked similar to a cellula or small room inhabited by monks.
Development of microscopy:
- 1590: Hans and Zacharias Janssen, as Dutch lens grinders, mounted two lenses in a tube to produce the first compound microscope.
- 1660: Robert Hooke published <em>Micrographia</em>, containing detailed observations of biological materials made with the best compound microscope.
- 1676: Anton van Leeuwenhoek was the first person to observe a live cell under a microscope, i.e., the algae Spirogyra.
- 1931: Ernst Ruska constructed the first electron microscope. With the invention of the electron microscope, many infectious agents smaller than bacteria could be seen.
Until now, we can see how important the use of microscopes, especially in microbiology, that is the study of microorganisms.
<h3>Learn more</h3>
- How was the water filtered to remove debris and living organisms? brainly.com/question/5646770
- About the single bonds in fatty acids brainly.com/question/1386856
- The theoretical density of platinum which has the FCC crystal structure. brainly.com/question/5048216
Keywords: compound microscope, Robert Hooke, cells first observed, cork, dead plant, walls, Anton van Leeuwenhoek
Answer:
Geothermal energy would be your answer!
Explanation:
It is the energy produced from the steam of the earth.
hope it helps!