1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DerKrebs [107]
3 years ago
15

Summarize the Case Study from Science on pages 10 and 11 about the Pfennig experiment. In the summary, explain how their experim

ent illustrates the scientific process.
Biology
1 answer:
pantera1 [17]3 years ago
4 0

Answer: 3 hundred and twenty

Explanation:

You might be interested in
What can you learn from observing and comparing the physical traits of different birds?
sergeinik [125]
You can learn their traits such as the color of the feathers and where they came from or originated from
8 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Who is credited with creating the first accurate model of dna
riadik2000 [5.3K]
<span>The two scientists, who are credited with creating the first accurate model of DNA are JAMES WATSON and FRANCIS CRICK. The success that these two scientists achieved concerning DNA structure is based on the works of other scientists, who have carried out series of research on DNA. The real proof of Watson - Crick model for DNA was released in 1982, this was after the B form of DNA was crystallized and its X ray pattern was solved.</span>
4 0
3 years ago
Read 2 more answers
Through which microscope were cells first observed?
poizon [28]

Compound microscope

<h3>Further explanation</h3>

In 1665, Robert Hooke used a compound microscope to observe cells. Hooke observes the cell walls of dead plants (in the form of cork) when they appear under a microscope. He named it the cell because it looked similar to a cellula or small room inhabited by monks.

Development of microscopy:

  • 1590: Hans and Zacharias Janssen, as Dutch lens grinders, mounted two lenses in a tube to produce the first compound microscope.
  • 1660: Robert Hooke published <em>Micrographia</em>, containing detailed observations of biological materials made with the best compound microscope.
  • 1676: Anton van Leeuwenhoek was the first person to observe a live cell under a microscope, i.e., the algae Spirogyra.
  • 1931: Ernst Ruska constructed the first electron microscope. With the invention of the electron microscope, many infectious agents smaller than bacteria could be seen.

Until now, we can see how important the use of microscopes, especially in microbiology, that is the study of microorganisms.

<h3>Learn more</h3>
  1. How was the water filtered to remove debris and living organisms?  brainly.com/question/5646770
  2. About the single bonds in fatty acids brainly.com/question/1386856
  3. The theoretical density of platinum which has the FCC crystal structure. brainly.com/question/5048216

Keywords: compound microscope, Robert Hooke, cells first observed, cork, dead plant, walls, Anton van Leeuwenhoek

3 0
3 years ago
Read 2 more answers
What does it mean and what do i do??????????
Nat2105 [25]

Answer:

Geothermal energy would be your answer!

Explanation:

It is the energy produced from the steam of the earth.

hope it helps!

3 0
3 years ago
Other questions:
  • Which of these statements is not true of the phylogenetic tree?
    8·1 answer
  • Which of the following sex and generation combinations directly produces the pollen tube of angiosperms?A) male gametophyteB) fe
    9·1 answer
  • Superior inferior vena cava
    10·1 answer
  • How do conditions change as the depth of the ocean water increases
    7·2 answers
  • Plants produce which of the following as waste products?
    7·2 answers
  • A scientific theory _____.
    15·2 answers
  • Question 5 answer right answer
    7·1 answer
  • Which of the cell components is least likely to affect the visible traits of an organism?
    15·2 answers
  • Pls help ):)
    13·1 answer
  • Can samone help me fill this diagram ​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!