1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vivado [14]
3 years ago
14

Mammals produce milk to nurse their young. In humans, which hormone controls milk production?

Biology
1 answer:
DedPeter [7]3 years ago
4 0

Answer: C. Prolactin

Prolactin is a hormone that controls milk production together with oxytocin. The anterior lobe of the pituitary gland secretes prolactin and the posterior lobe secretes oxytocin when a baby suckles at the breast. The level of prolactin in the blood slowly increases during pregnancy, and stimulates the growth and development of the mammary tissue, in preparation for the production of milk after delivery.

Moreover, Prolactin is in the highest level in about 30 minutes after the beginning of the feed, which is most important for producing milk for the next feed.

You might be interested in
Select the correct answer from each drop-down menu. Sickle cell disease is passed on from parent to offspring. Sickle cell disea
allsm [11]

Answer: All the statements of the question are correct.

Sickle cell disease is an autosomal recessive disorder that is characterized by formation of defective hemoglobin protein, which results in sickle shaped RBC ( red blood cell).

This disease is caused by mutation in the gene that is responsible for the protein hemoglobin ( which transport oxygen throughout body).

It is inherited by the offspring when both the mutated copy of genes ( one from each parent) are passed to him.

Carriers of the disease exhibit increased resistance to malarial parasites by controlling the level of free haem in the blood ( through enzyme heme oxygenase that produces a toxic carbon monoxide gas). The resistance thus developed, is a mutation.

Therefore, all the statements in the given question are correct.

5 0
3 years ago
LESSON 5: bio 1A Cells and homeostasis
Kobotan [32]
Is this actually a question? Lol.
3 0
3 years ago
Read 2 more answers
Salt is notoriously dangerous to land snails; however, some populations of aquatic, freshwater snail have brackish (or a mix of
Mashutka [201]

Answer:

The brackish water adaptation is clearly necessary because the aquatic snails need to live in an environment in which the river system has a higher quantity of salt than what land snails can take. I can determine that the environmental factors influenced the inherited adaptations because the second population has a higher salt concentration in their habitat compared to the initial population.

8 0
3 years ago
A marine scientist observes that dissolved oxygen decreases with increasing ocean depth. He concludes that deep sea creatures mu
Dimas [21]

Answer: B.) More research is needed to reach a conclusion, including related variables

Explanation:

As it is evident that oxygen is necessary element for living beings. It is required for the process of respiration, in which the food particles are broken down in the presence of oxygen into simpler substances.

Applying this knowledge to the given study suggests that all organisms require oxygen which can be less or more depending upon their habitat either in the shallow waters or in the depths. This conclusion is invalid and requires more explanatory approach which can be achieved by more research so as to derive a valid conclusion in which the two variables oxygen and relative habitats can be compared.

5 0
3 years ago
What would happen if earth had no atmosphere??
Hitman42 [59]
There would be no life
5 0
4 years ago
Read 2 more answers
Other questions:
  • Why are mitochondria bigger in animal cells
    12·1 answer
  • Which of the following correctly explains how some bacterial infections can become difficult to treat with antibiotics?
    6·1 answer
  • What transplanted genre would be least useful for a host cell
    13·1 answer
  • Why is it important for people to study environmental science.
    14·2 answers
  • A cell will use this type of division when it needs to produce exact copies of itself. What is it? ​
    8·1 answer
  • What do you call elements the body needs, but only in small amounts?
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which of the following is an example of predation?a) the vivid colors of the poison-arrow frog in Costa Ricab) a hawk swooping d
    8·1 answer
  • What might happen to the rate of diffusion if the blood flow were to speed up?
    10·1 answer
  • There are five species of the Texas state flower, the bluebonnet. Each flower is found in a different region of Texas and has sl
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!