1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
9

You can adapt to a sunny environment bywearing sunglasses.jogging.listening to music.none of the above( i tried but im stuck i c

ant remember which one)
Biology
2 answers:
Doss [256]3 years ago
7 0
<span>The best and most correct answer among the choices provided by the question is the first choice. One can adapt to the sunny environment by wearing sunglasses. I hope my answer has come to your help. God bless and have a nice day ahead!</span>
Bingel [31]3 years ago
7 0
<span>You can adapt to a sunny environment by wearing "Sun-Glasses"

In short, Your Answer would be Option A

Hope this helps!</span>
You might be interested in
How “Competition in an ecosystem” is playing a role in life?
Ket [755]

Answer:

Competition is an interaction between organisms or species in which both the organisms or species are harmed. Limited supply of at least one resource (such as food, water, and territory) used by both can be a factor.

Explanation:

7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
which process would probably create the most rapid change in earths surface ? A erosion B heating Cvolcanic eruption or D weathe
bogdanovich [222]
Volcanic eruption would change the surface the quickest
6 0
3 years ago
What cells were chloroplast present in? What did they look like in the various cells?
kenny6666 [7]
They are only present in plant cells an they are green pigment and where photosynthesis take place
6 0
3 years ago
Genetically modified (GM) crops are foods that have had their genomes modified, allowing humans to increase the production of ce
postnew [5]

Answer:

B-Farmer A's crops cross-pollinated with Farmer B's crops on the neighboring land.

Explanation:

6 0
2 years ago
Read 2 more answers
Other questions:
  • Approximately how old is the Earth
    14·2 answers
  • Eggs with tough protective shells developed to
    7·2 answers
  • The process of cellular respiration, which converts simple sugars such as glucose into co2 and water, is an example of _____. vi
    5·1 answer
  • Bright sunlight shines in the eyes of a human. This is an example of:
    13·2 answers
  • In muclticellular organisms, the cell cycle produces groups of cells that perform the same function. What are these groups of ce
    5·1 answer
  • Chuck Wildlee, a baseball pitcher, was struck on the head by a line drive hit by Charley Hussel. Fortunately, Chuck was not seri
    14·1 answer
  • An earthquake decimates a ground-squirrel population, killing 98% of the squirrels. The surviving population happens to have bro
    15·1 answer
  • PLEAAE HELP WITH LAST BIOLOGY QUESTION!!!
    8·1 answer
  • What are hydrogen bonds caused by?
    11·1 answer
  • What type of fish is this?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!