1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solmaris [256]
2 years ago
9

What is an example of the bystander effect

Biology
1 answer:
alexira [117]2 years ago
6 0

Answer:

When someone is openly getting bullied and pushed at, but no one helps

Explanation:

This post was made by alessdaiwastaken. If this helped you, please mark Brainliest. If it didn't, then feel free to correct me!  

You might be interested in
What kind of genetic disorder is pictured in the pedigree?<br><br> A. Recessive <br> B. Dominant
Vanyuwa [196]

Answer:

The answer is B Im pretty sure

Explanation:

Hope This Helps

Have A Great Day

~Zero~

5 0
2 years ago
Also this one, which type of crystal is this?
valentina_108 [34]

Answer: Looks similar to a smoky quartz.

3 0
3 years ago
n 1928, Fred Griffith performed an experiment revealing that genetic material can be passed _____. This experimental system was
nekit [7.7K]

Answer:

In 1928, Fred Griffith performed an experiment revealing that genetic material can be passed between two different stains of the bacteria.

Explanation:

In 1928, Frederick Griffith, a British bacteriologist conducted some experiments to develop a pneumonia vaccine. He used mice and two strains of Streptococcus pneumoniae bacteria, known as R and S in his experiments.

The live R strain bacteria had a rough appearance and were nonvirulent. When he injected R bacteria into mice, they did not cause pneumonia. The live S strain bacteria had a smooth appearance due to their polysaccharide coating and were virulent. When injected into mice, the mice died as a result of pneumonia. The polysaccharide coating protected the S bacteria from the immune system of the mice.

Griffith then injected mice with heat-killed S bacteria (the heat killed the bacterial cells) and they did not cause pneumonia in mice. But when he injected a combination of non-lethal R bacteria and non-lethal heat-killed S bacteria into mice, the mice died from pneumonia. When he examined the blood sample from the dead mice, he found that the blood sample contained live S bacteria. This finding leads him to the conclusion that the nonvirulent R-strain bacteria had been "transformed" into virulent and lethal S-strain bacteria by taking up a "transforming principle" from the heat-killed S bacteria.

This experiment was then used for additional experiments conducted by Avery, McCarty, McLeod and then by Hershey and Chase. They found the evidence that the transforming principle from Griffith's experiment was actually the hereditary material, DNA. The DNA of the S strain bacteria had survived the heating process. This DNA that contains the genes for the production of the protective polysaccharide coating was taken up by the R strain bacteria. The transformed R strain bacteria were now protected from their host's immune system and this process of transferring genetic information between different bacterial strains is known as transformation.

8 0
2 years ago
Name the regulatory factor in childbirth
lilavasa [31]
Homeostasis or the source of body heat
3 0
2 years ago
How does fever indicate that your body immune system it's doing its job?
photoshop1234 [79]
Ur body heats up to kill the bacteria in ur body
7 0
2 years ago
Other questions:
  • PLEASE HELP!
    8·1 answer
  • Relate mgmt methylation to central dogma
    14·1 answer
  • Please help me on this
    12·1 answer
  • 1) The main difference between a prokaryotic cell and a eukaryotic cell is
    15·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Why might two elements possess similar chemical properties
    15·1 answer
  • How are DNA and RNA different
    12·1 answer
  • Which type of cloud is most likely to produce precipitation?
    9·1 answer
  • Help me figure this out!!!
    5·2 answers
  • Please help I don't understand ​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!