1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
3 years ago
5

How might a carbon atom from a orange peel in a trash can for a week, end up in an animal's lungs? (Think of how during cellular

respiration an organism takes in oxygen and glucose, and then what happens? Think of where the Carbon is in the reactants & then where the Carbon ends up in the products, Please explain your answer making sure to be very specific & detailed
Biology
1 answer:
defon3 years ago
3 0

Answer:

An orange peel in a trash will start to decompose.

  • The carbon atoms will be released into the air as a result of decomposition.

  • These carbon atoms will be converted into carbon dioxide in the atmosphere.

  • Plants will take in this carbon dioxide for making food by the process of photosynthesis.

  • When animals will consume the pants, the carbon products will be accumulated int he body of the animals. Some of the carbon will be converted into carbon dioxide in the animals and will pass out of the animal's body through respiration.

You might be interested in
Which of the following is not a property of an acid?
kondaur [170]
Answer: D. helps in digestion
Explanation: Gastric juice in the stomach contains HCL which creates an acidic condition(pH1.5-2.0) which is optimal for the action of enzymes in the stomach. HCL stops the activity of salivary amylase & helps to kill bacteria in food. It doesn’t help in digestion cuz it is not an enzyme.
7 0
3 years ago
What are the primary sites of protein production in a living eukaryotic cell?
Scorpion4ik [409]
Hi!

The answer is ribosomes.

Hope this helps!

-Payshence xoxo
3 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Guys do you see that profile 402557 on the daily ranking she is posting wrong answers to questions go and report her.
bija089 [108]

Answer:

Yess i do and thanks for the warning i will report her

Explanation:

Thanks :)

7 0
2 years ago
Which characteristics belong to a eukaryote?CHECK ALL THAT APPLY PLS HURRY
Gala2k [10]

Answer:

Try answer B that should be correct

Explanation:

6 0
3 years ago
Other questions:
  • Ecology is the study of the differences between plants and animals in their environment
    10·1 answer
  • What is the main purpose of the organ system shown below?
    14·2 answers
  • Miami-Dade County Public Schools
    5·1 answer
  • What was one possible reason evolutionary thought remained stifled in the seventeenth and eighteenth centuries?
    10·1 answer
  • Which domain would hagfishes, primitive vertebrates, be classified in?
    14·1 answer
  • Which is the layer underground where all empty spaces are filled with a
    6·2 answers
  • Which best describes ideal growing conditions for fungi?
    7·2 answers
  • Many insects have a tough outer shell called _____. an exoskeleton cellulose an endoskeleton chitin
    7·1 answer
  • What do viruses bacteria protozoa and parasites have in common
    9·2 answers
  • Which is a primary function of a vacuole in a cell​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!