1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olegator [25]
3 years ago
11

Two identical twins live in the same city; one smokes and one doesn’t. The one who smokes develops lung cancer. What is the best

reason for this?
A.
mostly genetics factors

B.
genetics and environmental factors

C.
mostly environmental factors

D.
it was not related to their genetics or environment
Biology
1 answer:
klio [65]3 years ago
4 0
C. mostly environmental factors
You might be interested in
What is the range of length and width of the tsunami wave?
natka813 [3]

Answer:

500-600 miles per hour (in deep water) 20-30 miles per hour (near shore)

Explanation: i dont know if this is the length and width of a tsunami wave but its the mph... hope this kinda helps :)

3 0
3 years ago
Read 2 more answers
How are plants of the savanna's highly specialized to grow in this environment of long periods of drought?
dexar [7]

Answer:

In trees, most savanna adaptations are to drought--long tap roots to reach the deep water table, thick bark for resistance to annual fires (thus palms are prominent in many areas), deciduousness to avoid moisture loss during the dry season, and use of the trunk as a water-storage organ (as in baobab).

7 0
3 years ago
Most stars seem to move across the night sky because
Otrada [13]
The correct answer is a.
7 0
3 years ago
Read 2 more answers
Drdffy dyrduftsesy dyrfyhvdrsytfg trfujhkg
ankoles [38]

Answer:

yee

Explanation:

7 0
3 years ago
1.-Identify the different ways in which evolution can occur?
Jobisdone [24]
1. These four factors can effect ways evolution occur:

<span>1.) Mutation 
2.) selection
3.) Gene Flow
4.) Genetic Drift 

2.  </span>In biology, a mutation is the permanent alteration of the nucleotide sequence of the genome of an organism, virus, or extrachromosomal DNA or other genetic elements.

Selection, in biology, the preferential survival and reproduction or preferential elimination of individuals with certain genotypes by means of natural or artificial controlling factors.

In population genetics, gene flow is the transfer of alleles or genes from one population to another.

<span>Genetic drift  is the change in the frequency of a gene variant in a population due to random sampling of organisms. </span>
4 0
3 years ago
Other questions:
  • Which human activity negatively affects the stability of the environment? A. Cutting down all trees in a forest B.Recycling pape
    10·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The most accurate definition of artery is a vessel that
    12·2 answers
  • The major site of photosynthesis in plants occurs in
    9·1 answer
  • What’s the difference between phylum and division
    12·1 answer
  • 15 WILL GIVE BRIANLIEST
    14·1 answer
  • Which of the following statements best defines the term operon?
    5·1 answer
  • Fast!!! Which is a FALSE statement about the blood that leaves the heart through the pulmonary artery? A. It is deoxygenated. B.
    5·1 answer
  • A _____ that is placed to the right of the element's symbol tells how many atoms of that element are in the formula.
    8·1 answer
  • Help me plsss!!!!!!!
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!