1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikitadnepr [17]
3 years ago
7

Prokaryotic flagella has the same internal structure as eukaryotic flagella.

Biology
2 answers:
Zinaida [17]3 years ago
5 0

The internal structure of prokaryotic flagella is the same as the internal structure of eukaryotic flagella. Prokaryotic cells do not contain endoplasmic reticulum, Gold bodies, mitochondria, plastids, or membrane-bound vesicles.

Alex3 years ago
4 0

Answer:

No, they do not have the same internal structure.

Explanation:

Prokaryotes lack the presence of a nucleus and a cell wall. The size and complexity of the ribosomes and how the cells reproduce are different in prokaryotes and eukaryotes. In eukaryotic cells, the ribosomes are bigger, more complex and bound by a membrane.

You might be interested in
Wich bread molds the fastest rye or white bread?
Eduardwww [97]
The white bread will mold the slowest because there is less density
8 0
3 years ago
Canine teeth of human beings are called vestigial organs and archaeopteryx is called a bridge animal,why?​
Alexxandr [17]

Canine teeth are not as useful as it is in animals while archaeopteryx has the character of both birds and reptiles.

<h3>What are vestigial organs?</h3>

The vestigial organs are those organs that have no apparent function in the body which means that the body can do without them.

Examples of vestigial organs in the body are:

  • appendix

  • wisdom teeth

The canine teeth is a type of teeth in mammalian dentition and is said to be vestigial because man can do without it.

Archaeopteryx are animals that has the characteristics of both birds and reptiles because it bears wings like birds and has hands it uses to crawl like a reptile.

Learn more about vestigial organs here:

brainly.com/question/1350219

7 0
1 year ago
What one is true this is due soon.
dsp73

Answer:

(B) Genes make up chromosomes.

Explanation:

Your answer is B.

4 0
3 years ago
Which is the main source of money used to pay for public primary and secondary schools?
Scorpion4ik [409]
A. Cuz the school gets money from the state
8 0
3 years ago
Read 2 more answers
What does the existence of arctic coal tell scientists?
iVinArrow [24]

Answer:

That there used to be an abundance of plants and animals that lived there. Does this help?

Explanation:

Coal forms from dead things from the past being subjected to high pressure.

8 0
2 years ago
Other questions:
  • Which part of the atom is directly invovled in chemical changes ?
    11·1 answer
  • How are homologous structures such as forelimbs evidence for common descent
    6·1 answer
  • A population of pea plants has 25% dwarf plants and 75% tall plants. the tall allele, t, is dominant to dwarf (t). what percenta
    11·1 answer
  • Which step of the scientific method do you perform after you state the problem?
    15·2 answers
  • The difference between mitosis in plant and animal cells is
    11·1 answer
  • Reflect your understanding on : ‘Corona VIRUS ‘
    5·1 answer
  • transcribe the highlighted portion of DNA into mRNA transcription mRNA copies of DNA into RNA using complementary bases
    7·2 answers
  • HURRY!!!! Please!!!!!
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is nuclear energy?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!