Answer:
Serine
Explanation:
The genetic code indicates the way by which the four bases of the messenger RNA (i.e., Adenine, Uracil, Guanine and Cytosine) are read in the ribosome to convert them into a protein. In this code, each codon is composed of three nucleotides that encode a single amino acid. Serine (S) residue can be synthesized by AGC (as in this case), AGU, UCA, UCC, UCG and UCU codons. The sequence above indicated (AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA) will be traduced in the following 5'-3' Frame: S-WAGAEKVR-, where the second codon is a stop codon (UGA).
Answer:
28.6 kg
Explanation:
The final weight can be calculated from the mixing data and formulae which is given as follows:
cement content =
Computing the parameters and checking the tables gives 28.6 kg.
Solution :
Given :
d = diameter of the wire of the spring = 0.074 in
= 0.188 cm
R = mean radius of coil
= 1.08 cm
G = modulus of rigidity of carbon steel wire =
L = length of wire of spring = 2 inch
∴ L = 5.08 cm
k = spring constant
k = axial load/ axial deflection
..................(1)
This is taken from the Torsion equation,
∴ From equation (1)
So the axial compression is = 1.57 cm
Axial load required W= k x δ
= 11334 x 1.57
= 177.95 N
Answer:
YES
Explanation:
values other than five will work