1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliya0001 [1]
3 years ago
5

Scientists have recently modified the bacteria that cause tooth decay by inserting a fragment of DNA into the bacteria's DNA tha

t prevents it from producing lactic acid. What is the new DNA called?
foreign DNA
restriction DNA
recombinant DNA
transgenic DNA
Biology
1 answer:
zzz [600]3 years ago
5 0

Answer:Recombinant DNA

Explanation:Recombinant DNA is basically a genetically modified DNA that is produced in the laboratory by bringing together different strands of DNA and causing them to bond in order to form a new genome or gene sequence and the whole procedure in performed in Vitro (in laboratory)

The DNA sequence is then inserted into the host to induce specific type of responses.

You might be interested in
What is a lysosome?
AVprozaik [17]
I believe the answer is B.
4 0
3 years ago
Read 2 more answers
What type of muscle is the inside of the uterus lined with?
vitfil [10]
The endometrium is the inner lining. The myometrium is the thick middle muscle. The serosa is the outer smooth layer.
7 0
3 years ago
A substance prepared from killed or weakened pathogens that is introduced into the body to stimulate an immune response is known
snow_lady [41]

The hepatitis B and the human papillomavirus (HPV) vaccines are made this way. The vaccine is composed of a protein that resides on the surface of the virus. This strategy can be used when an immune response to one part of the virus (or bacteria) is responsible for protection against disease.Jun 28, 2016

 


3 0
3 years ago
A specialty area that focuses on the connections between brain activity and mental processes is known as
Dmitry [639]
Its known as the cognitive neuroscience
7 0
3 years ago
You are observing a tissue under the microscope and see long, cylindrical, striated, multinucleate cells, arranged parallel to e
Colt1911 [192]

The tissue is identified as skeletal muscle tissues. These muscle tissues are long, cylindrical, striated, multi nucleate cells and are arranged parallel to each other

Skeletal muscle is one of three major muscle types other than the cardiac and smooth muscle. Most skeletal muscles are attached to bones by bundles of collagen fibers known as tendons.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Energy is released from atp when
    7·1 answer
  • Hector is back from his morning run and is feeling lightheaded because his energy is depleted. Which food item will provide him
    12·2 answers
  • Need help with this ??
    7·2 answers
  • How did the Byzantine Empire help to shape the modern world?
    7·2 answers
  • Explain the difference in results for the inheritance of the wing and fire-breathing genes vs. the inheritance of the wing and h
    10·2 answers
  • What is the ratio of surface area to volume for a sphere with the following
    8·2 answers
  • Blood picks up oxygen from the lungs from tiny sacs called (answer choices: Alveoli, Stomata, Villi, Cell Membrane) and transpor
    10·1 answer
  • A string is pulled tight. A machine causes it to vibrate at different frequencies. What will happen to the vibrations in the str
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which two of these characteristics does an organism with bilateral symmetry possess?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!