1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol13
4 years ago
6

According to the CDC, how many children have a developmental disability?

Health
1 answer:
photoshop1234 [79]4 years ago
8 0

Answer:

The answer is C

Explanation:

You might be interested in
What is the name for a healthcare professional who is an expert in a specific field of medicine?
just olya [345]
The name of this is a "specialist"
4 0
4 years ago
Read 2 more answers
Which type of Fitness is demonstrated by catching a baseball in a baseball mitt?
statuscvo [17]
I don't understand the question. It sounds like a trick question.
6 0
3 years ago
Read 2 more answers
Onset of puberty during late childhood
Ratling [72]
Being. Able to save money on less years of menstration
6 0
3 years ago
Read 2 more answers
Select the statement that best describes the specific roles of white blood cells in the immune system
Maurinko [17]
T cells attack antigens on foreign substances and B cells produce antibodies.
5 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Other questions:
  • Which statement explains one way that coping strategies are helpful?
    5·2 answers
  • The force exerted against the arterial walls when the heart contracts is called _________________. arterial relaxation systolic
    10·1 answer
  • The oThe organization of cells into tissues allows for
    6·1 answer
  • Planning is a technique used when a subject is moving <br> True or false
    12·1 answer
  • When people don’t clearly recognize the cause of their frustration, they
    11·1 answer
  • What is the first step to take when making a decision to eat healthy foods?
    13·2 answers
  • Ossification is
    15·2 answers
  • How does resistance training prevent osteoporosis?
    10·2 answers
  • Upon arriving at the scene of an emergency what questions might the 911 operator
    10·2 answers
  • To get reliable information:
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!