1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Phoenix [80]
3 years ago
8

Where does the first stage of respiration take place?

Biology
1 answer:
liberstina [14]3 years ago
8 0

It takes place in cytoplasm

You might be interested in
Drinking alcohol during pregnancy negatively impacts development of the fetus because: A: the mothers body is unable to process
horrorfan [7]
The answer is B. alcohol crosses the barrier that the placenta creates

The placenta usually consist of several layers of cells that act as a barrier for the diffusion of substance that connect the maternal and fetal circulatory system that very important for the fetus' growth. But sadly, it can't block Chemical really well and alcohol can screw it u
4 0
3 years ago
Read 2 more answers
Multiple Alleles are caused by what? A) Mutation B) incomplete dominance c) recessive genes d) none of the above
BaLLatris [955]

they are caused by mutation. the best example of it are human blood groups.

3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
One side of ur face is identical to the other side you are
Nataliya [291]

Answer:

yeah otherwise it would have being abnormal

4 0
3 years ago
Read 2 more answers
How many chromosomes are in a human oogonia?
Natasha_Volkova [10]

oogonia no result of oogonia  human

ovogonia:Esto quiere decir que la ovogonia tenía 46 cromosomas como se afirmó anteriormente, y el ovocito debe sufrir una reducción por medio de la denominada Meiosis hasta tener 23 cromosomas, 22 cromosomas somáticos y un cromosoma X (22X), el cual es el número Haploide

I hope it helps you.

8 0
3 years ago
Other questions:
  • You are given this hypothesis: “if beans are grown in soil with compost, then they will grow at the same rate as beans grown in
    10·2 answers
  • What are the basic building blocks of DNA and RNA?
    15·2 answers
  • Answer asap!!!
    8·1 answer
  • Every Friday Jane uses a special disinfectant to clean the exam rooms. She used the last bottle last Friday and the order for a
    6·1 answer
  • you should describe the events and changes that happen to you and your friends as you journey through the light independent reac
    9·1 answer
  • A species of frog slowly dies off because it cannot compete with the toads and lizards that share its ecosystem. This is an exam
    10·2 answers
  • What type of cells have a high concentration of mitochondria?
    14·1 answer
  • How would you describe extreme weather?
    13·2 answers
  • Can somebody tell me if this is right or not.
    15·1 answer
  • What does the word bio mean?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!