1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
barxatty [35]
2 years ago
7

If water were a nonpolar molecule, how would the properties of water be different? A. Water would not be as heavy a molecule.

Biology
2 answers:
Tasya [4]2 years ago
8 0
I think it would be C
expeople1 [14]2 years ago
3 0

its b. water would not rise inside plants

You might be interested in
Is pain a sign or symptom
tigry1 [53]
Pain is more defined as a symptom
4 0
3 years ago
When cells produce atp, where do they get energy from
galina1969 [7]
Cells<span> need a source of </span>energy<span>, they </span>get<span> this </span>energy<span> by breaking down food molecules to release, the stored chemical </span>energy.This process is called 'cellular<span>respiration'. The process is happens in all the </span>cells<span> in our body. Oxygen is used to oxidize food, main oxidized food is sugar(glucose).</span>
7 0
3 years ago
The latin word porus means passage. how does this meaning relate to the pores of the skin
Amiraneli [1.4K]
It relates to the meaning of the pores of skin because it lets in and out only certain things. 

I hope this helps, Sweetie. 
8 0
3 years ago
Read 2 more answers
In a water molecule the electrons are not equally shared , creating a ____ molecule .
zalisa [80]

Answer:

Polar

Explanation:

In a water molecule, the oxygen atom is bigger and has a greater pull on the electrons than the hydrogen atoms do. This makes the molecule polar.

3 0
2 years ago
All maps include bias because no map can___ 15 points!
lyudmila [28]
No map can accurately and proportionally represent every country’s size in proportion to another. For example, most maps the USA shows Texas as the largest states, but on a globe, Alaska is by far bigger. Hope this helps!
7 0
3 years ago
Read 2 more answers
Other questions:
  • HURRY PLEASE 30 POINTS
    12·1 answer
  • A 4-day-old infant is admitted to the pediatric unit with a cleft lip and palate. surgery to repair the lip is scheduled for lat
    8·1 answer
  • Hormones are secreted by exocrine glands directly into a body cavity or onto a body surface, rather than being transported by th
    12·1 answer
  • Using a compound light microscope worksheet
    7·1 answer
  • Monosaccharide is to carbohydrates as ________ is to protein
    13·1 answer
  • according to the World Wildlife Fund roughly when did humans start using more of Earth's resources than can be replenish
    8·1 answer
  • Responding to the environment is a characteristic of life best shown by which example?
    13·2 answers
  • How can a hunter help wildlife conservation efforts? A, By making sure to always obey the rules of firearm safety By making sure
    11·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Based on the diagram which statement describes sexual reproduction?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!