1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PolarNik [594]
2 years ago
11

Provide an adaptive and a nonadaptive hypothesis for the evolutionary loss of useless organs, such as eyes in many cave-dwelling

animals. How might these hypotheses be tested
Biology
1 answer:
Zepler [3.9K]2 years ago
3 0

In order to be able to Provide an adaptive and a non-adaptive hypothesis, the following is required

<h3>What is adaptation?</h3>

It refers to a trait or an integrated set of traits that increases the fitness of an organism. It is the process of improving the fit of phenotype to environment through natural selection.

<h3>What is non adaptation?</h3>

it refers to those traits that do not result in the better adaptation of the organism to its environment, and does not increase the genetic fitness of the organism.

Let us take the case of vain organs. There may be a metabolic value to constructing a vain organ, and subsequently the humans who have misplaced that organ might also have a selective advantage. Also, if the organ is useless, the mutations that disrupt the improvement of that organ would be evolutionarily neutral, and may want to unfold to fixation via genetic drift.

So an adaptive hypothesis as to why an organism may lose useless organs is energy trade offs. The organism may additionally be losing energy in growing and retaining a vain organ, whilst this strength can be higher used someplace else. So an organism that lives in a darkish cave might also sooner or later lose its eyes considering eyes are of no use inside a darkish cave.

A non adaptive hypothesis for the evolutionary loss of organs can be random mutation. If a random mutation occurs that causes an organism to lose its eyes, in a dark cave where it does not use its eyes anyway, it could still survive, reproduce and pass that mutation down.

For more information on adaptive hypothesis, visit

brainly.com/question/975242

You might be interested in
Which statement BEST describes why mycelium, constructed of hyphae, are necessary for fungi survival?
mariarad [96]

Answer:

Hyphae absorb nutrients from the environment and transport them to other parts of the thallus.

Explanation:

The large volumes of hyphae within the mycelium perform a fundamental role by obtaining nutrients from the organic substrates from the surrounding of the fungus. Hyphae play different kinds of functions in fungi.

They contain cytoplasm or cell sap. They also contain the nuclei, which include genetic material. Hyphae absorb nutrients from the environment and transport them to other parts of the thallus.

The thallus is the fungus body in which the fungi live or from beneath the soil to give support to the fungi for its growth and its survival.

5 0
3 years ago
Explain how parasitism differs from commensalism.
babymother [125]
<span>Commensalism is an interaction in which one of those species would benefit, and the other one would not be affected. Parasitism is an interaction in which one of those species would benefit at the expense of the host organism. Thus, in commensalism we have one positive and one neutral result while in parasitism we have one positive and one negative result.</span>
8 0
3 years ago
Read 2 more answers
What part of the body to elephant tusks form from
Alexus [3.1K]
The elephants skull, I believe.
6 0
3 years ago
Read 2 more answers
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Ribosome receive direction's from hereditary material to make certain.........
Rina8888 [55]

Answer: Proteins

Explanation:

The process where ribosomes use the mRNA to make proteins is called translation.

7 0
2 years ago
Other questions:
  • Please help me with this bio question
    8·1 answer
  • What would happen if the cells kept dividing and wouldn't Tay in interphase?
    10·1 answer
  • Explain why biomes are not tyically classified by temperture
    10·2 answers
  • Scientists have discovered by looking at fossil records that the ancestors of flying squirrels did not have flight membranes and
    14·1 answer
  • What is the function of plants?
    13·1 answer
  • What is the purpose of the stripes kn the giranium plant
    11·1 answer
  • Which of the following would be an example of a cartilaginous fish?
    15·1 answer
  • List ten importance of conservation of wildlife​
    10·1 answer
  • Define Greenhouse Effect. Does earth need a greenhouse effect to support life? What is currently happening with the greenhouse e
    7·1 answer
  • All of these statements are incorrect EXCEPT: _______________
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!