1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adell [148]
3 years ago
12

Which trend do the data in the maps support ??

Biology
2 answers:
zloy xaker [14]3 years ago
3 0

i think that the land is warmer

7nadin3 [17]3 years ago
3 0

Answer: In the given maps, there shows the temperature anomalies in both land as well as sea surface. In the sea surface, the temperature anomaly ranges from -5°C to 5°C which is comparatively lesser than the land temperature i.e -12°C to 12°C.

Thus from the provided data in the map, we can conclude that the average temperature in the land surface is more than the sea surface because the sea surface has the capacity to reflect back heat to the atmosphere but land surface cannot reflect much of it, thereby becomes more warmer as it absorbs most of the incoming solar radiations.

You might be interested in
Free points<br> How many planets are there in the solar system?
Rina8888 [55]

Answer & Explanation:

Here's the order of the planets, starting nearest the sun and working outward through the solar system: Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune — and Planet Nine.

3 0
4 years ago
Read 2 more answers
Which actions could be categorized in the “aerobic” section of the Venn diagram?
BARSIC [14]

Answer:

start process with gulcose

Explanation:

simple

3 0
3 years ago
An air pressure of 1,005 millibars is equivalent to approximately how many inches of Mercury?
s344n2d4d5 [400]

Answer:

2145

Explanation:

7 0
4 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Using the table, which statement is true?
kirza4 [7]

Your answer would be B.

8 0
4 years ago
Other questions:
  • When a doctor needs to give someone a medication intravenously (through a vein), they dilute that medicine in a saline solution
    8·1 answer
  • In c4 and cam plants carbon dioxide is fixed in the _____ of mesophyll cells.
    5·1 answer
  • If a gene has 4 exons how many proteins can be made
    8·1 answer
  • Producers are the most important biotic factor in an ecosystem<br><br>true or false?
    6·1 answer
  • What is mitosis and where does it occur
    7·1 answer
  • Hi I need some help on these two questions
    9·1 answer
  • Which of the following factors would affect population distribution but not size in a given country
    6·1 answer
  • Plz help with science questions I need help
    7·1 answer
  • What is the mean arterial pressure if some has for 150/90 blood pressure
    10·1 answer
  • Can some one please help me on this question
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!