Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:A is the answer
Explanation:Hope you get it right
Answer:
Novobiocin target DNA GYRASE of gram positive bacteria.
Explanation:
Novobiocin is a bacteriostatic(slow down bacteria growth) or bactericidal i.e it kills bacteria , narrow spectrum antibiotics that target DNA GYRASE of gram positive bacteria. It acts by inhibiting the bacteria DNA gyrase hydrolysis thereby by interfering with the metabolic activities of bacteria. It is also a weak catalytic inhibitor of mammalian. Novobiocin inhibit DNA gyrase and topoIV by binding to the ATP pocket of GyrB and ParE, respectively.The Streptomyces strain that produces Novobiocin and it is more effective on gram positive bacteria that gram negative bacteria because gram negative bacteria are resistant to it.
Vestigal organs are organs that, as we evolve, the organs loose their purpose and have no function anymore. The appendix is a vestigal organ
Hope this helps
