1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
3 years ago
10

13)

Biology
1 answer:
Julli [10]3 years ago
6 0

Multiply 5730 years by 2 since two half-lives have gone by for carbon.

<u>Explanation</u>:

The half-life of a radioactive isotope depicts the measure of time that it takes half of the isotope in an example decay. On account of radiocarbon dating, the half-existence of carbon 14 is 5,730 years  

The half-life of carbon-14 is 5730 years.  

In this manner, after  

1 half-life there is 50 % = 1/2 of the first amount left.  

2 half-lives there is 25 % = 1/4 of the first amount left.  

25% is two half-lives.  

Every 50% of life requires 5730 years.  

So two half-lives require 2 × 5730

You might be interested in
Classify each statement as a description of glycolysis, glycogenesis, glycogenolysis, or gluconeogenesis.
loris [4]

Glycolysis is the breakdown of glucose where the final product is pyruvate, glycogenesis is the process of formation of glycogen and the product in first step is glucose-1-phosphate. Glycogenolysis is the process in which the initial reactant is glycogen, and gluconeogenesis is the formation of glucose from pyruvate.

<h3>What is glycogen?</h3>

Glycogen is a type of carbohydrate that is stored in the liver and gets converted into glucose in emergency situations.

It is formed by the process of glycogenesis and the first-step product is glucose-1-phosphate.

Glycolysis is the breakdown of glucose where the final product is pyruvate.

Glycogenolysis is the process in which have initial reactant glycogen and occurs when brain and muscle require immediate energy.

Gluconeogenesis is the formation of glucose from pyruvate.

Thus, these were the explanation for glycolysis, glycogenesis, glycogenolysis and gluconeogenesis.

For more details regarding glycolysis, visit:

brainly.com/question/14076989

#SPJ4

5 0
1 year ago
Which of the following blood components provide the major defense for our bodies against viruses
Katarina [22]

Answer:

White blood cells

Explanation:

7 0
2 years ago
Who is it important to study the cell in order to learn about DNA?
victus00 [196]
It is important to study the cell in order to learn about DNA is that there many different processes that help to keep a cell running. In order to know DNA, you need to familiarize yourself with mRNA, tRNA, and rRNA to learn the process of transcription and translation- two very important processes in DNA.
7 0
2 years ago
Chains are made up of two or more of these and found on a chromosome 
r-ruslan [8.4K]

Answer:

I keep finding DNA so my best guess would be RNA

Explanation:

8 0
2 years ago
In a study where participants rated the pleasantness of T-shirt odors, what gene alleles influenced their odor preference? a. Se
Harrizon [31]

Answer:

Major histocompatibility complex

Explanation: In a variety of animals, including humans, there is a correlation between odor preference, and genetic similarity at the Major Histocompatibility Complex (MHC).

MHC is a highly polymorphic group of genes that play an important role in the immunological self/non self recognition. Its products have been recognised to take part on the numerous compounds and reactions that build up an individual's body odor.

4 0
3 years ago
Other questions:
  • Which of the four basic substances on this ph scale is slightly basic?
    14·1 answer
  • _____ phase is the period during the life of a cell between the end of mitosis and the synthesis of more genetic material. G0 ph
    9·1 answer
  • What is Acid Reflux? Name two treatments for acid reflux, and explain how they work.
    5·2 answers
  • Pure water is neutral what is the appropriate justification for this
    15·1 answer
  • Are mutations always bad? explain your answer
    5·1 answer
  • A mutation caused some normally black-and-white peppered moths to be all
    11·2 answers
  • __________ refers to the ability of an individual to survive and reproduce, whereas __________ is any inherited characteristic t
    13·1 answer
  • The bacteria inside a tube worm would be analogous to what organism in the ocean ecosystem near the waters surface?
    5·1 answer
  • Classify each thing abiotic or biotic.
    7·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!