1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmainna [20.7K]
3 years ago
13

The newborn's brain is about 25 percent of its adult weight by birth; by the second birthday, the brain is about ________ percen

t of its adult weight.
Biology
1 answer:
Alina [70]3 years ago
7 0
<span>50 percent. Newborn has very low listening ability and learning as brain develops the child will learn new things and his brain starts to grow big .Brain will adapt the language,color ,light,people faces and then child will learn fast</span>
You might be interested in
How are atp and adp related?
erastova [34]
ATP is adenosine triphosphate, it is like a fully charged battery in a cell, ADP is basically ATP that has been drained of its energy from a chemical reaction. It is like a dead battery that can be recharged later   ;)
5 0
3 years ago
On the ph scale which value is considered neutral <br> A-7<br> B-5<br> C-11<br> D-2
mariarad [96]

Answer:

the answer is letter A-7

5 0
3 years ago
1. What is the primary function of DNA?
OverLord2011 [107]

Answer:

To store genetic information to pass on to other living organisms.

4 0
3 years ago
Read 2 more answers
If the Pacific Ocean is rimmed by the Ring of Fire, what can we conclude about the plate boundaries in that region?
bulgar [2K]
If the pacific ocean was rimmed by the ring of fire we can conclude that the plate boundaries are constantly moving
3 0
3 years ago
PLEASE HELP. I need the answer now
Tomtit [17]

Explanation:

i didnt pay attention last year soooo sorry

5 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is one benefit to a plant living on land to a plant living in water
    14·2 answers
  • put the processes of the water cycle in the correct order starting at the point where the water is in a lake
    10·2 answers
  • What is the average for the following set of measurements?
    10·1 answer
  • What have the ability to neutralize antigens?
    8·1 answer
  • Which of the following climates is a high-latitude climate?
    6·1 answer
  • Since velocity describes both speed and direction, you can call it
    7·2 answers
  • During which season do the rays of the sun hit the Earth at the MOST indirect angle? A) fall B) spring C) summer D) winter
    15·1 answer
  • Please heeeeeeeeeeeeeeeellp
    14·1 answer
  • What is the first step of the scientific method?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!