1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
drek231 [11]
3 years ago
13

How does a population reach carrying capacity?Give examples.

Biology
1 answer:
Mashcka [7]3 years ago
4 0

Answer: By either emigration or natural increase.

Explanation: Natural increase is where in a population, the birth rate, or number of live births per year, is greater than the death rate, or deaths per year. Emigration is when individuals leave their region to move to another, often due to economic or political reasons. Eventually, a population will reach its carrying capacity, where the land the population occupies is only just able to support the population. Once the carrying capacity is breached, the population will start to collapse.

You might be interested in
BRAINLIESTTT ASAP!!!
FromTheMoon [43]
Temperature affects a star size and the light it emits and it also affects it luminosity. When a star is cold it usually emits a blue color and when its hot it emits a reddish color. For example, up close to the sun it appears red, this is because the temperature is hot.
.
Hope this helps :)
4 0
3 years ago
Approximately how much of Earth's surface is covered by water?
SVETLANKA909090 [29]

Answer:

71%

Explain-About 71 percent of the Earth's surface is water-covered, and the oceans hold about 96.5 percent of all Earth's water. Water also exists in the air as water vapor, in rivers and lakes, in icecaps and glaciers, in the ground as soil moisture and in aquifers, and even in you and your dog

5 0
3 years ago
The American Sequoia is found only in
Dimas [21]
The native is the best way
6 0
3 years ago
Read 2 more answers
So in mitosis, you end up with the same amount of chromosomes. Yes or no
stiks02 [169]

Answer:

Yes you do end up with the same amount of chromosomes

Explanation:

In mitosis the amount of chromosomes do not get split up and the amount remains the same.

3 0
3 years ago
Read 2 more answers
How are some humans using more than their fair share of water? What is the effect of using water on environmental systems?
Troyanec [42]
Some humans are using more than their fair share of water and it is having a huge impact on the environment. People tend to let their water run while brushing their teeth or shaving, and those are just two of the major problems. There may also be leakages, which can waste gallons among gallons of water. Wasting water hurts humans, it leaves them with less accessible, usable water. Additionally, wasting too much water can hurt the local environment as it drains too much water away from the natural ecosystem.
6 0
3 years ago
Read 2 more answers
Other questions:
  • The movement of water molecules through the environment is known as the
    6·1 answer
  • A light is traveling straight up out of the ocean, then moves out of the air. how do you expect the movement of the light wave t
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • In a certain population of red squirrele, a mutation causes several squirrels to
    7·2 answers
  • What is found at the center of a cell?<br> eukaryotes<br> molecule<br> nucleus<br> vacuoles
    11·2 answers
  • An experiment was carried out to answer the question “Does the pH of water affect the
    14·2 answers
  • You are throwing a disco-themed party and decorate with some small white flowers that have a delicate fragrance. During the part
    9·1 answer
  • What is a science can any one answer​
    13·1 answer
  • Scientists conduct investigations to answer questions. Before making a valid conclusion, scientists must-
    10·1 answer
  • Agricultural burning contributes to what kind of air pollution
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!