The cell membrane is very important to the cell structure. It helps hold everything within the cell and serves as a protective covering as well.
If mutation destroys the function of the Cas9 gene then the bacteria will not be able to target a specific bacteriophage for destruction upon infection for the second time.
<h3>What is the Cas9 gene?</h3>
- Cas9 is a 160 kilodalton protein that plays a vital role in the immunological defense of certain bacteria against DNA viruses and plasmids and is heavily utilized in genetic engineering applications.
- Its main function is to cut DNA and thereby alter a cell's genome.
- Although Cas9 is an endonuclease and is evolved as a mechanism of immunity against viruses, they are not considered restriction enzymes.
To learn more about the Cas9 gene,
brainly.com/question/22549100
#SPJ4
Answer:
I'll inform them that the possibility of all their future children/offspring being phenotypically sickle-celled is very high.
Explanation:
Sickle cell is an inherited disease condition in which the red blood cells of the blood loses its shape and hence, dies or gets broken down. It has to do with the blood genotype of an individual. There are three major types of blood genotypes in humans namely: AA, AS, and SS. SS is the recessive genotype that codes for the sickle cell trait.
Hence, a human with the sickle cell trait has a genotype- SS. Therefore, according to this question, a man and a woman, each with sickle-cell trait (SS), were planning to marry, This will mean that both the man and the woman will always produce a gamete with S allele, which will combine to form an SS offspring. In other words, all of the offsprings of this man and woman will be sickle-celled.
I'm pretty sure your talking about Vertebrates
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T