1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataliya [291]
3 years ago
7

What phase is Homologous chromosome paired.

Biology
1 answer:
kumpel [21]3 years ago
4 0

In metaphase I of meiosis I, the pairs of homologous chromosomes, also known as bivalents or tetrads, line up in a random order along the metaphase plate. The random orientation is another way for cells to introduce genetic variation.

You might be interested in
In at least two sentences, describe the functions of the cell membrane: why is it important
Ainat [17]

The cell membrane is very important to the cell structure. It helps hold everything within the cell and serves as a protective covering as well.

3 0
3 years ago
Read 2 more answers
A strain of bacteria has a CRISPR-Cas system, but a mutation has destroyed the function of the Cas9 gene. How will the strain of
bogdanovich [222]

If mutation destroys the function of the Cas9 gene then the bacteria will not be able to target a specific bacteriophage for destruction upon infection for the second time.

<h3>What is the Cas9 gene?</h3>
  • Cas9 is a 160 kilodalton protein that plays a vital role in the immunological defense of certain bacteria against DNA viruses and plasmids and is heavily utilized in genetic engineering applications.
  • Its main function is to cut DNA and thereby alter a cell's genome.
  • Although Cas9 is an endonuclease and is evolved as a mechanism of immunity against viruses, they are not considered restriction enzymes.

To learn more about the Cas9 gene,

brainly.com/question/22549100

#SPJ4

7 0
2 years ago
If a man and a woman, each with sickle-cell trait, were planning to marry, what information could you provide them regarding the
kiruha [24]

Answer:

I'll inform them that the possibility of all their future children/offspring being phenotypically sickle-celled is very high.

Explanation:

Sickle cell is an inherited disease condition in which the red blood cells of the blood loses its shape and hence, dies or gets broken down. It has to do with the blood genotype of an individual. There are three major types of blood genotypes in humans namely: AA, AS, and SS. SS is the recessive genotype that codes for the sickle cell trait.

Hence, a human with the sickle cell trait has a genotype- SS. Therefore, according to this question, a man and a woman, each with sickle-cell trait (SS), were planning to marry, This will mean that both the man and the woman will always produce a gamete with S allele, which will combine to form an SS offspring. In other words, all of the offsprings of this man and woman will be sickle-celled.

7 0
2 years ago
All animals which possess a spine are included in the same
Vaselesa [24]

I'm pretty sure your talking about Vertebrates

8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • These compounds store genetic information.
    15·1 answer
  • 1. The plant life that is characteristic of a biome depends upon:
    9·1 answer
  • Acid rain is wearing away at a statue in the town square. What process is causing this?
    7·1 answer
  • Enzymes are substances that speed up the rate of chemical reactions. The rate of enzyme
    7·1 answer
  • Which structure does this organism use for movement?
    6·1 answer
  • Magnesium deposits are most likely to form from:
    11·1 answer
  • 18. Which is the primary advantage to sexual reproduction over asexual reproduction?
    6·1 answer
  • If someone adds thousands of small fish to a lake, how would the number of big fish<br> change?
    9·1 answer
  • The evaporation of water from the stomata is known as...
    7·1 answer
  • Explain Genotype Vs phenotype with examples
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!