1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
3 years ago
15

4.

Biology
1 answer:
Luden [163]3 years ago
6 0
4. DNA sequence comparison

5. Random mutations 


You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
One of the more common causes of ____ is an electrical power variation.
scZoUnD [109]
System failure is one of the more common causes.
6 0
3 years ago
Which adaptation to a dry climate most helps the elephant tree continue to grow by reducing the loss of moisture?
natulia [17]

a - a deep root system

8 0
3 years ago
The most likely result of this process is
Archy [21]

if you told me what process i could help you - post a new question and ill try to help you

8 0
3 years ago
What is animal husbandry ??​
Savatey [412]

Answer:

the science of breeding and caring for farm animals.

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • In which case will a sound wave travel the fastest ?
    12·1 answer
  • PLS ANSWERRRRRR Describe how a developed vent community is replaced with a new community.
    13·1 answer
  • How can a measure of density help identify a substance ???
    9·1 answer
  • The first quartile of a data set is 32, and the third quartile is 52. One of these values in the data set is an outlier. Which o
    9·2 answers
  • You eat a candy bar to get you through a late-night studying session. Your body quickly begins to break down the macromolecules
    8·1 answer
  • What is mutation?Define it ​
    10·2 answers
  • Explain why the chemical equation for photosynthesis is a simplified representation of the process. How is the equation accurate
    5·1 answer
  • Match the terms to their definition. 1. constructive a process in which the edge of one crustal plate sinks below the edge of an
    5·1 answer
  • In ______ reproduction, genetically identical offspring are produced, while in ______ reproduction, offspring are genetically di
    5·2 answers
  • A farmer wants to breed a variety of taller corn.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!