Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
I recall that Professor Kwang had observed amoebas that had cannibalized bacteria cells. The bacteria were slaughtering the amoebas, but somehow some survived. This particular group of amoebas contained bacteria that thrived inside it. Hence the name, endosymbiosis. However, this lucky group and it's offspring could not survive without bacteria.
I think the answer to you r question is C. bc with no sunlight at the bottom the temp is affected. Also I looked up photosynthesis and it said that scientist have found this at the bottom of the ocean so it in fact does perform more photosynthesis
What do you think?
Answer:
The bicondylar angle positions the center of mass above the base of support during the single-support phase of bipedal locomotion.
A. True
Explanation:
The bicondylar angle is the functional angle between the diaphysis of the femur, perpendicular to the intercondylar plane. Very unique to humans, this angle places the knee and the foot under the body's center of gravity during a single support phase of locomotion or gait. With hip joints set lateral to the body's midline, the bicondylar angle aligns the lower limb with the center of gravity, thereby facilitating human movement.
