1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marshall27 [118]
3 years ago
12

I didn’t get how to do it

Mathematics
1 answer:
Marina CMI [18]3 years ago
8 0

Answer:

K = 5

Step-by-step explanation:

Since 2 on the numerator would equal one, five would equal 2 and a half plus the other 1/2 which would make 3.

You might be interested in
∫ 5cos(x) - 2sec²(x) dx
daser333 [38]
\bf \displaystyle \int [5cos(x) - 2sec^2(x)]dx\implies 5\int cos(x)dx~-~2\int sec^2(x)dx
\\\\\\
5sin(x)-2tan(x)+C
5 0
3 years ago
Evaluate<br> 3.r” + 2y when r<br> 3 and y<br> 3
aleksandr82 [10.1K]

Answer:

first 2x3= 6

3.3 + 6 = 9,3

answer should be 9,3

3 0
2 years ago
Original price: $35<br> Percent of discount:<br> Sale price: $31.50
AlladinOne [14]

Answer:

ok i agree

Step-by-step explanation:

6 0
3 years ago
How many different ways can you make change for $.50 using only nickels,dimes, and quarters?
yanalaym [24]

Answer:

10 ways

Step-by-step explanation:


5 0
3 years ago
Find the area of the composite figure​
SOVA2 [1]

Answer:

The answer is 49

Step-by-step explanation:

the square = 10×4= 40

The triangle = 6×3= 18 >> 18÷2 = 9ft

40+9= 49ft

4 0
3 years ago
Other questions:
  • I need help (4x/7) - 0.6= 3.6
    13·2 answers
  • Mr. Andropolis wanted to leave the waiter a 12% tip at the restaurant where he ate lunch. If his bill came to $32.46, how much m
    11·1 answer
  • Can someone help me with these questions please?
    12·1 answer
  • David must install fencing around a lot that is shaped like a right triangle. The side of the lot that runs east-west is 200 ft
    15·1 answer
  • The polygons are similar find the values of the variables
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Water has a density of 1.0 g/cm3. What is the mass of 10.0 cm3 of water?
    9·2 answers
  • ¿Cuál de las siguientes fracciones es menor? <br>5/2 1/4 1/2 8/10​
    9·1 answer
  • Write the decimal as a fraction
    6·2 answers
  • Y/5-6= -16 Find what y is.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!