1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhuklara [117]
3 years ago
5

Describe the difference between organic and inorganic carbon.

Biology
1 answer:
xeze [42]3 years ago
4 0
The primary difference between organic vs. inorganic compounds is that organic compounds always contain carbon while most inorganic compounds do not contain carbon
You might be interested in
A tornado strips out a section of a forest. What type of succession is this? Why?
Archy [21]

Answer:

Secondary succession

Explanation:

A secondary succession is when a type of disturbance happens when there is <em>already </em>soil present. In this case, it has already started out with a forest (including plants, trees, and wildlife). Other examples of a secondary succession include a wildfire, hurricane, flood, or human destruction.

This is different from a <em>primary succession</em>. A primary succession occurs when  there is <em>no</em> soil present.

3 0
3 years ago
Heart and kidneys are called organs,why?​
sertanlavr [38]

Answer:

they are so for..

both of them are comprised of similar tissues working together to perform a particular task.

4 0
3 years ago
Read 2 more answers
Which label belongs in the area marked x?
anygoal [31]

Answer:

we need to see the diagram

Explanation:

3 0
3 years ago
Read 2 more answers
DFG and JKL are complementary angels. m DFG=x+2,and mJKL=x-4. Find the measure of each angle
Mariana [72]
This is not a biology question this is a math question
7 0
3 years ago
Read 2 more answers
Any gene that can turn a normal cell into a tumorous cell is called an
Molodets [167]

It would be an oncogene, these can be inherited mutations of proto-oncogenes that cause the oncogene.

4 0
3 years ago
Other questions:
  • On a rock outcrop that has never been home to living organisms, what is likely to be the first organism to grow there?
    6·1 answer
  • Imagine a car as a model that represents the human body, with its parts performing various functions similar to human body syste
    8·1 answer
  • The chemical process for respiration
    5·1 answer
  • What is the main difference between the central nervous system (cns) and the peripheral nervous system (pns)?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • These blood vessels carry waste products, such as carbon dioxide to the heart
    14·2 answers
  • True/ False: Substances will diffuse more rapidly through a dense substance. Explain
    13·2 answers
  • Explain How do organisms in an ecosystem depend on detritivores?
    13·1 answer
  • *PLEASE ANSWER!! ILL PICK BRAINLIEST*
    12·1 answer
  • Explain how diffusion allows the small intestine
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!