1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
777dan777 [17]
3 years ago
12

Do you think that president roosevelt used his power wisely when he issued executive order 8802?

Law
1 answer:
aleksandr82 [10.1K]3 years ago
6 0

Answer:

Yes I believe so give everyone the same fighting chance no matter ethics or color skin its business you have to be professional and not racists.

Explanation:

You might be interested in
9. What ultimately happened to Clarence Earl Gideon?
disa [49]

Answer:

Accused of committing a robbery, Gideon was too poor to hire a lawyer to represent him in court. ... After he was found guilty and sentenced to five years in prison, Gideon took his case to the U.S. Supreme Court

4 0
3 years ago
Read 2 more answers
Which part of the Constitution discusses the structure and operation of the government?
-BARSIC- [3]
B is the best answer
3 0
3 years ago
Read 2 more answers
When did everybody wants to rule the world come out.
kap26 [50]
Everybody wants to rule the world January 1 1985
3 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Of the problematic groups discussed in the unit, which one is most similar to the Mexican drug cartels? Which one is the most di
Rama09 [41]
Answer please say which groups were discussed in the unit
6 0
3 years ago
Other questions:
  • What is the highest rank in police jobs?
    13·1 answer
  • Who is the president of nigeria​
    9·2 answers
  • A republican form of government means that
    10·2 answers
  • Which of these actions is most likely to be permitted in dealing with a person with limited English proficiency?
    8·1 answer
  • Why is the speaker recognized as the head of the US Congress ?
    14·1 answer
  • Ideas, beliefs, or attitudes about what is important are _________.
    5·1 answer
  • I feel like when I try to hit the folks dance, I am doing the woah because I forgot how to hit the hit the folks.
    10·1 answer
  • Think about coverage you’ve seen of high-profile crimes or court cases. What do you think is helpful about media coverage of the
    9·1 answer
  • For what reason were the alien and sedition acts unpopular with most americans?.
    6·1 answer
  • Hi so if someone backstabs me what do I do
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!