1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
3 years ago
9

Identify an appropriate control that the researchers should use when they study the growth and photosynthetic ability of the pla

nt with the mutant enzyme
Biology
1 answer:
natka813 [3]3 years ago
5 0
The plant should remain the same
You might be interested in
An ice cube that is dropped into a glass of water melts because A. heat energy moves from the ice to the water. B. the ice is de
Sedbober [7]
The answer to this question is a
3 0
3 years ago
Read 2 more answers
Unlike other animals, mammals can perspire. The main benefit of perspiring is that it -
Fudgin [204]
The skin is cooled through evaporation.
8 0
3 years ago
A man who smokes heavily has developed lung cancer. The tobacco smoke has caused mutations in some of the cells in his lungs, ma
Naya [18.7K]

Answer:

The correct answer is: B. If he inherited a mutation which made him more susceptible to lung cancer, it may have been present in some of the gametes he produced and passed to his children.

Explanation:

  • The inheritance of genes from the parents to the offspring is mediated by the germinal cells or sex cells or gametes of the parents.
  • The genetic material present in the somatic cells of the parents are not transmitted to the offspring.
  • In the given case, the man who develops lung cancer generates some tobacco smoke induced mutations in some of the cells of his lungs.
  • The cells of the lungs are type up of somatic cells. Hence, any mutations in the genome of these cells will never be transmitted to the offspring.
  • Therefore, the children of the man will never become prone to develop lung cancer due to development of mutations in the lung cells of the man.
  • However, if the man has inherited any mutation from his parents which can increase the risk of development of lung cancer, then these mutations will be present in his germinal cells and also in some of his gametes.
  • Now, if a child is born due to the fusion of the the maternal gamete with one of these mutated paternal gametes, there is an increased chance of developing lung cancer in the child, irrespective of the fact whether he is a smoker or a non-smoker.

3 0
3 years ago
Choose all the answers that apply.
Dmitrij [34]
Time of day, Wind Patterns, and Weather
3 0
2 years ago
Read 2 more answers
Which of the following does not explain why if two people are exposed to the same high stress causing conditions, there is a lik
e-lub [12.9K]

Answer:

Probably B

Explanation:

They all explain it, honestly, but B sounds the least like an answer they would accept as true. It's also kind of sus that they have 2 different answers about reacting differently to stress, and B is definitely the least likely of the two to be correct. Sorry I couldn't be more helpful, I'm only here because I searched for the answer myself. Good luck.

8 0
2 years ago
Other questions:
  • Which of the following equations represents the right chemical process that occurs in photosynthesis A.six molecules of oxygen s
    8·2 answers
  • How does the body react when the outside temperature gets too hot?
    6·1 answer
  • What is a specialized form of diffusion
    6·1 answer
  • Name the ridged bundles of muscle found projecting inside the right atrium. View available hint(s) name the ridged bundles of mu
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is a body cavity called?
    10·1 answer
  • Explain how predation, disease, and competition impact a population-based upon scale and distribution of the organisms.
    11·1 answer
  • Which of the following will occur if the concentration of membrane-impermeable solutes in the intracellular fluid of a cell is h
    11·2 answers
  • Is cellular respiration an endothermic or exothermic reaction
    7·1 answer
  • Explain why it is difficult to keep people who are sick off of planes.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!