1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
11

Why is it important to understand levels of organization in living systems in terms of both structure and function of each level

?​
Biology
1 answer:
vampirchik [111]3 years ago
5 0

Answer:

The living world can be organized into different levels.

Levels of organization are structures in nature, usually defined by part-whole relationships, with things at higher levels being composed of things at the next lower level. Typical levels of organization that one finds in the literature include the atomic, molecular, cellular, tissue, organ, organismal, group, population, community, ecosystem, landscape, and biosphere levels.

Explanation:

Yet, in spite of the ubiquity of the notion, levels of organization have received little explicit attention in biology or its philosophy. Usually they appear in the background as an implicit conceptual framework that is associated with vague intuitions. Attempts at providing general and broadly applicable definitions of levels of organization have not met wide acceptance. In recent years, several authors have put forward localized and minimalistic accounts of levels, and others have raised doubts about the usefulness of the notion as a whole.

Just helps a lot overall, especially if you are planning to go into a field related to biology.  Hope this helps! :)

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
I need help with this science question. Thank you!
mart [117]

Answer:

a. 25 N ---> Direction: Right

b. 40 N ---> Direction: Right

c. 10 N --->  Direction: Right

d. 90 N <--- Direction: Left

e. 40 N down Direction: Down

Hope this helps!

8 0
3 years ago
Which sentences identify the characteristics of a prokaryote
krok68 [10]

Answer:

their nuclear material is naked not membrane bound

6 0
3 years ago
Choose all the answers that apply.
____ [38]

increase because of carbon

4 0
2 years ago
Read 2 more answers
Why do leaves appear green?
s2008m [1.1K]

<u>Answer:</u>

The correct answer option is B. Green wavelengths are the least used in photosynthesis.

<u>Explanation:</u>

Plants have a pigment in them called as chlorophyll. This chlorophyll is able to absorb only certain wavelengths of the light within the light spectrum.

From that visible light spectrum, chlorophyll is only able to absorb light of red and blue wavelength. The green light is not absorbed by the by chlorophyll as it is reflected back.

Therefore, this reflection of green light makes the leaves to appear green.

6 0
2 years ago
Read 2 more answers
Other questions:
  • A material that has_____can be split fairly easily along planes with weak atomic attraction
    15·1 answer
  • Human evolution is a subject of much discussion. Humans share many traits with other apes yet over the millennia, humans have ev
    10·2 answers
  • .
    13·2 answers
  • Question 14
    10·1 answer
  • In the picture, the stomata on the underside of the leaf will ____________ when the turgor pressure within the guard cells incre
    9·2 answers
  • Cholesterol belongs to which class of molecules?
    8·1 answer
  • Which of these is a goal that a female might set for herself in order to
    9·1 answer
  • Which statements describe the Sun? Check all that apply.
    13·2 answers
  • Can you help me out with this one plz
    5·1 answer
  • Which of the following organelles is properly matched to it's function?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!