1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lena [83]
3 years ago
11

Science is two things. Describe what those two things are.

Biology
1 answer:
Murrr4er [49]3 years ago
7 0
<span>Science is two things. Science is a vast topic. It deals with everything you see, you hear, feel, touch, and more.
With regards to this two things, maybe it means about defining science in your own terms and opinion. You can say science is about experiment and observation or science is about life and death, etc.
</span>
You might be interested in
What do aerobic respiration and anaerobic respiration have in common?
VARVARA [1.3K]
They both provide energy for the body. They both occur in the muscle cells.
8 0
4 years ago
PLEASE i need SERIOUS HELP!
madreJ [45]

Answer:

send me the link to that website and ill research it for you

Explanation:

5 0
3 years ago
Please help me as soon as possible
miss Akunina [59]
7 bc it has more trees
8 0
3 years ago
Plants take in nutrients and water through their roots and then transport these materials to the rest of the plant. Photosynthes
Nataly [62]

Answer:

I believe it is the plasma in our bloodstream

Explanation:

plasma holds most of the nutrients in our body and flows in our blood transporting them through our body.

6 0
3 years ago
Read 2 more answers
Why can’t your body heal an amputation the same way it can heal a cut?
Pani-rosa [81]

Answer:

because the mother sells are less for that kind of cuts so they don't regenerate and in a cut its easier because they are just in number for that cut

Explanation:

8 0
3 years ago
Other questions:
  • Stable ecosystems can be altered, either rapidly or slowly, through which of the following events?
    6·1 answer
  • The combining form that refers to the male gland that encircles the upper end of the urethra is:
    9·2 answers
  • Who is the scientist that gave cells their name
    8·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is the mean of 20.0 20.5 21.10 21.5 22.0 22.0 22.5 22.5 23.0 23.0
    8·1 answer
  • The brain is the main organ of the: circulatory system nervous system digestive system excretory system
    6·2 answers
  • According to the food chain, label the following organisms appropriately. 1. secondary consumer cat 2. primary consumer grass 3.
    8·1 answer
  • The group that includes gorillas, chimpanzees, bonobos, and humans is called the
    8·2 answers
  • Which of these was the world’s first artificial satellite?
    11·2 answers
  • What is the difference between gradualism and punctuated equilibrium?.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!