1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
12345 [234]
3 years ago
6

Convert 0.9% glucose to g/100ml?

Biology
2 answers:
wlad13 [49]3 years ago
6 0

Answer:

If we consider a solution density of 1 g/ml, it is 0.9 g/100ml

Explanation:

A solution 0.9% glucose can be expressed as follows:

\frac{0.9 g glucose}{100 g solution} \\

If the density of the solution (at a given temperature) is 1 g/ml, the solution concentration can be calculated as follows:

\frac{0.9 g glucose}{100 g solution} . \frac{1 ml solution}{1 g glucose} = \frac{0.9 g glucose}{100 ml solution}

So, to calculate a solution concentration in g/ml from a %w/w concentration you have to only divide it into the solution density. Remember that solution density depends on the temperature.

Pani-rosa [81]3 years ago
5 0

Convert a 0.9% glucose solution to g/ 100 ml.

How many grams of glucose would you need to add to 1 liter of water to make a 0.9% glucose solution?  Use dimensional analysis.

If you had a 0.9% glucose solution how many mol/L do you have?  Calculate glucose’s molecular weight first and then use dimensional analysis to calculate your final answer.

If you had a 0.9% glucose solution how many osmoles/L do you have?  You have to take into account how many particles glucose dissociates into.

If you had a 0.9% NaCl solution how many osmoles/L do you have?  You have to take into account how many particles NaCl dissociates into.

You might be interested in
Which structures should a student bond together to form two strands
vitfil [10]
D!!!! lol lol lol lol lol lol lol
3 0
3 years ago
For a thirsty person, drinking water serves to reduce a basal metabolic rate. b homeostasis. c an instinct. d the set point. e a
strojnjashka [21]

Answer:

e) a drive

Explanation:

We felt  thirsty when we have fluid imbalance in our body  either we have less water or we have more concentration of osmolytes such as sodium in blood. The brain detect the change produce the effect for the intake of water.

  • However thirst is a vital primordial emotion that motivates us for fluid intake. So the emotion produces a drive to quench it.
  • Some recent studies refers it as basic instinct to drink water.
5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Why do we drink water?
frez [133]

Answer:

To survive. Drinking is very important and is required for animals and organisms to survive. It also keeps us hydrated.

8 0
4 years ago
Read 2 more answers
A muskrat population is growing exponentially. What might cause this population to enter logistic growth? resources become scarc
amid [387]
A muskrat population is growing exponentially. What might cause this population to enter logistic growth?

Answer: One cause that might cause the population of this semi aquatic rodents to enter a logistic growth would be the elimination of predators from their environment and the increase of food. The reason being that they are rodents with an adaptable lifestyle and an omnivorous diet. With no predators they would quickly adapt to their environment and increase their birth rate.

I hope it helps, Regards.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Please help me do some of these whoever does the most get brainliest!​
    6·1 answer
  • ANOTHER EASY MULTIPLE CHOICE!!!! WORTH 12 POINTS
    13·1 answer
  • What systems contain the heart
    15·2 answers
  • Which of the following ecological roles is/are played by at least some fungi? Select all that apply.A) AutotrophyB) PredationC)
    8·1 answer
  • Which is one purpose of cell division?
    15·2 answers
  • What defines a symbiotic relationship?
    8·1 answer
  • The specialization in the structure and function of cells that occurs during the development of an
    14·1 answer
  • Which of the following is a sign of poor quality water? (2 points)
    11·1 answer
  • Which is a product in the following chemical reaction? CH2 + 2O2 - CO2 + 2H2O
    12·1 answer
  • A dog that has been trained to salivate at the sound of a bell is an example of _[blank]_.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!