1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
3 years ago
15

By raising their pressure-temperature enough, rocks may form

Biology
1 answer:
Zanzabum3 years ago
8 0
D all of these

Explanation:cus ik
You might be interested in
Classifying things by observation can best be done by using a
Ipatiy [6.2K]
The best way to do a observation can be a microscope or by taking notes ,and by , taking pictures or,  asking questions about the subject that you and the teacher or you, your teacher and the class is talking about .! Hope this helps ..
3 0
3 years ago
Use the drop-down menus to complete each sentence.
Nostrana [21]

Answer:an organism who make its own food is autotrophic

Explanation:

5 0
2 years ago
Scenario 2:
Akimi4 [234]

Answer:

I think he should undergo the DNA test.

Explanation:

Taking this DNA test could help Mike understgand his genetic makeup. If he does not take the test then he will forever wonder about his genetic makeup.

8 0
3 years ago
Read 2 more answers
The following diagram shows the branching tree diagram for some animals.
Alla [95]

Answer:

probably the kangaroo and chimpanzee because they both use their two legs to walk while the other animals dont

Explanation:

:)

5 0
4 years ago
Read 2 more answers
The atomic mass of an element whose atoms consist of eight protons, nine neutrons, and eight electrons is _____. (Ignore the per
Westkost [7]
<span>Atomic mass=Total number of protons + Total Number of neutrons.
Here
Total number of protons=8
Total number of neutrons=9
Atomic mass= 8 + 9
                     = 17
Answer is 17.</span>
5 0
3 years ago
Other questions:
  • Give an example of changes that occur during differentiation in a multicellular organism
    12·2 answers
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Which of the following help decrease heart disease and lower cholesterol?
    6·2 answers
  • Which three metals are found around hydrothermal vents?
    8·2 answers
  • Explain how musicians use wind instruments to play music?
    11·1 answer
  • Imagine that researchers publish a study that shows the following positive correlation: College students who spend more money on
    5·1 answer
  • Indicate the correct designation of the paired sex chromosomes.
    14·1 answer
  • Why is there no such thing as being a “carrier” of an autosomal dominant disorder?
    13·1 answer
  • What is this? Please have an explanation for your answer
    12·1 answer
  • What is radioactive dating
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!