1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
3 years ago
14

What effect does the heating of Earth have on air and water movement? PLEASE EXPLAIN

Biology
1 answer:
sammy [17]3 years ago
7 0
Heating of the Earth due to the Sun's rays causes convection currents of air upwards. The warm air moves upwards, while cool air from nearby regions fills in the lower areas. 
<span>Heating of the Earth can cause warm water currents that flow from hot areas like near the equator and tropical areas, while cold water currents flow from the arctic and antarctic regions and the temperate regions. </span>
You might be interested in
When did the last ice age reach its peak
GrogVix [38]

It stopped in 11,700 years ago

6 0
3 years ago
When electrons are lost, a<br> When electrons are gained, a<br> ion is formed,<br> lon is formed
miskamm [114]

Answer: when one is lost, one is formed

6 0
2 years ago
What type of model did Copernicus propose for the solar system?
Varvara68 [4.7K]
I believe it is D) heliocentric !
3 0
3 years ago
WITH SPECIFIC EXAMPLES, BRIEFLY DESCRIBE HOW FOOD CHAIN IS RELATED TO FOOD WEEB. Help please
mylen [45]

Answer:

A food chain outlines who eats whom. A food web is all of the food chains in an ecosystem.

Explanation:

Each organism in an ecosystem occupies a specific trophic level or position in the food chain or web.

6 0
2 years ago
Please help and explain.
horsena [70]
I got you :)


The molecular clock (based on the molecular clock hypothesis (MCH)) is a technique in molecular evolution that uses fossil constraints and rates of molecular change to deduce the time in geologic history when two species or other taxa diverged. It is used to estimate the time of occurrence of events called speciation or radiation. The molecular data used for such calculations is usually nucleotide sequences for DNA or amino acid sequences for proteins. It is sometimes called a gene clock or evolutionary clock.
4 0
3 years ago
Other questions:
  • Think about the structure and function of your backbone. why do you think there are discs of cartilage between the bones in the
    13·1 answer
  • By which process do human liver cells regenerate themselves cells
    9·2 answers
  • In which process does water move from the land to the air
    7·2 answers
  • What component do animals add to the atmosphere when they breathe?
    6·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is the difference between multicellular organism unicellular organisms? Give an example of each.
    6·2 answers
  • B) Describe the characteristic of DNA that determines which protein is formed.
    14·1 answer
  • Most people in Central Asia live in
    9·1 answer
  • Hey guys i am bòred wanna chàt​
    15·1 answer
  • The difference between plant and animal cells is:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!