1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
9966 [12]
3 years ago
13

Jessica recently moved to an apartment in the industrial area of Readington City. She noticed that the roads in her neighborhood

warm up quickly. She also noticed that the temperature in her apartment is typically much warmer than the temperature of her previous apartment, which was near the mountains on the outskirts of the city. What is responsible for the change in temperature?
A. Urban areas absorb more of the Sun’s radiation.
B. Mountainous areas don’t absorb the Sun’s radiation.
C. Mountain areas experience more precipitation.
D. Urban areas experience lower precipitation.
Biology
2 answers:
Musya8 [376]3 years ago
6 0

the answer is A. because the roads are black and take in more light which makes the area hotter

r-ruslan [8.4K]3 years ago
6 0

Answer:

The correct answer is option A, that is, urban areas absorb more of the Sun’s radiation.

Explanation:

The cause for the urban regions exhibiting a warmer climate in comparison to the mountainous regions is the maximum captivation of the radiation of the Sun by these regions. This is termed as the urban heat island effect. This results in the air to be warmer in comparison to the other regions.  

There are various causes related to the elevation in the temperature. One of the causes is exhibiting a huge number of roads and buildings in the urban regions. This takes part in the captivation of the heat from the Sun. Another cause is the absence of green plants, which absorbs the heat and the cools the surrounding.  

You might be interested in
Which of the following neurotransmitters typically has inhibitory effects?
solmaris [256]

The correct answer is: A) GABA

GABA or γ-aminobutyric acid is a type of amino acid that's found in proteins. It is the main inhibitory neurotransmitter in the brain which means that GABA reduces neuronal excitability throughout the nervous system. GABA binds to its receptors that are located on the neuron’s plasma membrane. This binding causes the opening of ion channels that transport chloride ions into the cell or potassium ions out of the cell.

6 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Which is a consumer?<br> A. algae<br> B. human<br> C. cabbage<br> D. carnation
QveST [7]

Answer:

Human

Explanation:

Everything else produces and photosynthesizes, humans are the only thing in the list that consumes

7 0
4 years ago
Read 2 more answers
What would happen to human blood cells if they were placed in a salt water solution?
OLEGan [10]

Answer:

The red blood cells will shrink in size when water diffuses out of them.

7 0
3 years ago
peoples choices can have a positive or negative effect on their health. describe one positive chocie and one negative health cho
Alina [70]
A positive choice to make to impact one's health is to simply wake up in the morning and get ready, and take time on yourself. That will ensure that you appreciate yourself and will give you a positive mentality throughout the day.

A negative choice to make to impact one's health is to constantly over-think situations, causing stress and an unhealthy state of mind. 
8 0
3 years ago
Other questions:
  • The 2nnumber for dogs in 78. how many chromosomes would you find in a dog's blood cell?
    14·1 answer
  • What is the organized way of using evidence to learn about the natural world
    6·1 answer
  • 4. This is the step in the scientific method in which you explain your results and whether your
    10·2 answers
  • Birds that fly have lightweight bones some of which are hollow how might this unique body structure benefit the bird?
    12·1 answer
  • How many different gametes can be produced from the genotype aabbddeeff?
    9·1 answer
  • Help asap An experiment originally begins with _____.
    12·2 answers
  • A solution that contains more solute than it would normally hold at the temp is sad to be
    5·1 answer
  • Someone help me pleaseeee
    10·1 answer
  • *AQUATICS SCIENCE*
    6·1 answer
  • Do animals have the right to a certain quality of life?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!