1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
15

Which of the following would you expect to find in the urine of a dehydrated person?

Health
2 answers:
nydimaria [60]3 years ago
6 0
<span>Which of the following would you expect to find in the urine of a dehydrated person?
</span>
Concentrated urine and high ADH concentrations in the blood
aksik [14]3 years ago
5 0

The correct answer is B. Concentrated urine and high ADH concentrations in the blood

Explanation:

Dehydration occurs as the intake of liquid or water is insufficient in relation to the amount of liquid your body loses or requires for normal functioning. This leads to thirst, fatigue and even death in the cases of prolonged, extreme, dehydration.

Additionally, dehydration can be identified based on urine and blood tests. In this way, in dehydrated people, urine is concentrated which means urine is dark and thick due to low levels of liquids in the body. Also in blood, there is a high antidiuretic hormone (ADH) or vasopressin levels, this occurs as ADH is a hormone that regulates the amount of water in the body and when dehydration occurs this hormone is excessively released to let your body know it is necessary to preserve water. Thus, if a person is dehydrated you can expect "Concentrated urine and high ADH concentrations in the blood".

You might be interested in
Explain different ways infections from different organisms can be treated. (Site 1)
Dmitry [639]

Answer:

Different ways are antibiotics, vaccines, ointment,creams and OCT medicine.

6 0
4 years ago
In what situation would you assume there is implied consent from a victim?
Alexxandr [17]
um probably B because if they are choking then there is no way for them to say anything
5 0
3 years ago
Horatio was born with malfunctioning kidneys. Which homeostatic disorder is he at most risk for?
Verdich [7]

Answer:

metabolic acidosis

Explanation:

Hope this helps!

4 0
3 years ago
Read 2 more answers
Which of the following is a benefit of cardiovascular machines?
Tamiku [17]
ANSWER : A


Explanation:
4 0
3 years ago
Which is not true?
velikii [3]

Answer:

A

Explanation:

National brands cost more due to how many there are

4 0
3 years ago
Other questions:
  • Which two layer of skin can separate to form a blister?
    11·1 answer
  • Which of the following is an activity that a student can participate in at school and temporarily avoid vigorous aerobic activit
    11·1 answer
  • A two-year-old child is on the same level as a ten year old child in terms of conflict resolution.
    5·2 answers
  • What must an applicant when taking their road test?
    6·1 answer
  • What organization is OSHA's sister agency that focuses on research and training and also conducts Health Hazard Evaluations (HHE
    13·1 answer
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • A child spends time in the woods and encounters a raccoon. She is bit and is sent to the doctor’s office for rabies vaccinations
    15·1 answer
  • How can I sleep better
    11·2 answers
  • PLEASE HELLLLLPPPPP MEEEEEE!!!!!!!!
    15·1 answer
  • Karina’s leg was in a cast for ten weeks. You would expect her leg muscles to experience some degree of:
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!