1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr1967 [171]
3 years ago
15

All but one factors plays a part in water movement in and out of the cell

Biology
1 answer:
murzikaleks [220]3 years ago
4 0
What are the functions of proteins within your body?
You might be interested in
The pulmonary circulation conveys blood that is ______ in oxygen to the lungs before returning back to the ______ side of the he
Oduvanchick [21]

The pulmonary circulation conveys blood that is low in oxygen to the lungs before returning back to the left side of the heart.

<h3>The pulmonary circulation</h3>

The circulatory system is divided into two main parts namely:

  • pulmonary circulation and

  • systemic circulation.

The pulmonary circulation involves the movement of blood between the lungs and the heart.

Blood from the systemic circulation returns to the right side of the heart where it is pumped through the pulmonary artery into the lungs to be oxygenated.

After oxygenation has taken place in the lungs, the blood returns to the left side of the heart through the pulmonary veins.

Learn more about systemic circulation here:

brainly.com/question/811428

3 0
2 years ago
Marine debris is best described as being composed of _______. a. solid garbage b. untreated sewage c. toxic chemicals d. things
Andreyy89
The answer would be d. things discarded by humans
4 0
3 years ago
Read 2 more answers
Directions
Mashutka [201]

Reviewing of articles summarizes the current state of understanding on a topic within a certain discipline.  

<h3>What is an article review?</h3>

This is a type of professional paper writing which demands a high level of in-depth analysis and a well-structured presentation of arguments and a critical evaluation of literature in a particular field through summary, classification, analysis, and comparison.

<h3>Introducing the main idea of an article:</h3>

The first sentence should explain the subject being discussed in the passage.

A signal phrase is a short introductory phrase that indicates that a quote or paraphrase is coming. To introduce a signal phrase, you provide an effective transition between your own ideas and the evidence used to explore your ideas.

To include a quote, use the author's last name and the page number from which the quotation or paraphrase is taken.

To include a sentence which discusses the quote chosen, you:

  • Use a full sentence followed by a colon to introduce a quotation.
  • Begin a sentence with your own words, then complete it with quoted words.
  • Use an introductory phrase naming the source, followed by a comma to quote a critic or researcher.

Hence, a review article is generally considered a secondary source since it may analyze and discuss the method and conclusions in previously published studies.

Read more about the <em>article review</em> here:

brainly.com/question/14443228

#SPJ1

4 0
2 years ago
Succulent plants, such as cacti, are most often found in which terrestrial biome? A. grassland B. rainforest C. desert D. tundra
vagabundo [1.1K]
The answer is: c. desert
3 0
3 years ago
Read 2 more answers
Which of the following describes how an animal welfare activist would feel about raising cows for food and leather?
Jet001 [13]

Answer:

Answer B

Explanation:

8 0
3 years ago
Other questions:
  • To be a member of the kingdom Animalia you would have ALL but one of these characteristics. What is NOT required to be classifie
    13·1 answer
  • Compare and contrast the locations of anaerobic and aerobic respiration in a typical eukaryotic cell. what are the by-products a
    11·1 answer
  • Genes are sections of DNA that code for a particular trait. Genes are
    6·2 answers
  • How are waves repeating patterns?
    12·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • How does acid precipitation cause rocks to weather faster
    14·2 answers
  • The ______ Theory explains the movement of water through the xylem cells from root to leaf.
    7·1 answer
  • When a surface is experencing friction with another surface how are the particle's affected<br>​
    7·1 answer
  • WILL MARK BRAINLIEST FOR CORRECT ANSWER!
    6·1 answer
  • Moving ridges of water on the surface of the ocean caused by wind and constantly cause weathering along the shoreline. *
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!