1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
12

When it rains, rainwater soaks into the ground and puts pressure on the existing water in the ground, forcing some o

Biology
2 answers:
nika2105 [10]3 years ago
7 0

Answer:

When you said forcing some o what does o represent?

Explanation:?

Angelina_Jolie [31]3 years ago
4 0

Answer:

What does o mean

Explanation:

Please make me brainliest

You might be interested in
3. jack is using plastic beads to model water molecules in each state of water. how shoule she the beads to represent water mole
just olya [345]

Jack should arrange the beads close together and slide past each other to represent water molecules in a liquid.

<h3>How are the molecules of water arranged when water is in its liquid phase?</h3>
  • Each water molecule contains two atoms of hydrogen and one atom of oxygen, arranged such that one side of the molecule (nearest the hydrogens) is positively charged while the other side (nearest the oxygen) is negatively charged.
  • They’re arranged randomly, and in random motion.
  • In fact, they’re not even keeping the same hydrogen atoms, as they are constantly popping off and reforming on the nanosecond time scale.

To learn more about water molecules,

brainly.com/question/2960517

#SPJ4

7 0
2 years ago
How is framing contributing to the decline in biodiversity
marin [14]
All forms of farming have major impacts on biodiversity, especially when new land is brought into cultivation. Habitats are destroyed and new ecological niches created which allow typical farmland species of birds, insects, mammals and weeds to establish themselves.
6 0
3 years ago
Read 2 more answers
1. Ms. Wagner loves to eat tomatoes. She wants to plant a garden and is trying to figure out how to grow plants
SVETLANKA909090 [29]

Answer:

Independent variable: The amount of fertilizer.

Dependent Variable : The amount of water, the amount of soil. amount of sun light.

Explanation:

I can't really explain it but I am pretty sure that is the right answer. Hope it helps :)

5 0
3 years ago
How would you use stearic acid
OLga [1]

Traditionally used as a thickening agent in lotion, this vegetable derived waxy substance is also used as a hardening agent in soaps (at a .5% of your oils as a usage rate). Stearic acid is also used as a hardening agent in candles, vegetable or paraffin based.

5 0
3 years ago
The ________ is a substage lens that concentrates light on the specimen.
stiks02 [169]

Answer:

microscope's condenser

Explanation:

The microscope's condenser is a substage lens that concentrates light on the specimen.

<em>The condenser of a microscope is a structure that helps concentrate light rays from the light source to illuminate the specimen on the stage of the microscope. It is made up of a system of lens that converges the ray of light and an aperture diaphragm that can be used to control the amount of light that gets to the specimen on the stage of the microscope.</em>

6 0
3 years ago
Other questions:
  • More energy can be released from a fat molecule than from a glucose molecule because the fat molecule has more
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is the difference between the independent and the dependent variables in an
    11·1 answer
  • If a population grows larger than the carry capacity of an ecosystem, the
    9·2 answers
  • Ort-Answer Questions<br>How can you say that cutting of paper is a physical change?​
    5·1 answer
  • DNA is copied, in a process called _______, so that a cell's DNA can be passed on to its daughter cells. A. recombination B. re
    5·2 answers
  • Which form of precipitation is water that falls as chunks of solid ice?
    13·2 answers
  • We know gender differences are based in biology because all cultures practice the same gender norms and ideologies.
    13·2 answers
  • Other kinds of white blood cell have a different way of killing
    13·1 answer
  • Describe one method for temporarily storing carbon in the natural cycle.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!