1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tatiana [17]
3 years ago
5

Beyond their role in energy transfer, what other benefit do microorganisms that act as producers provide for ecosystems?

Biology
1 answer:
insens350 [35]3 years ago
6 0

Answer:

The microorganisms present metabolic wastes that serve as the primary source of food for other living things.

Bacteria that live free in the soil or in symbiosis with plants are essential to fix nitrogen, both nitrates and ammonia. These bacteria take nitrogen directly from the air, originating compounds that can be incorporated into the composition of the soil or living beings.

This property is restricted only to prokaryotes and is widely distributed among different groups of bacteria and some archaeobacteria. It is a process that consumes a lot of energy that occurs with the mediation of the enzyme nitrogenase, which the rest of the living organisms that cannot do or comply with this process is because they lack said enzyme.

Dunaliella is a genus of microscopic algae of the Chlorophyceae class and of the order Volvocales. All are unicellular, although with very varied morphologies.

Morphologically, its main characteristic is that they lack a rigid polysaccharide cell wall.

The ecology of this genus of green algae is characterized by its high tolerance to salinity, with eukaryotic organisms having greater tolerance to salt. They are euryhaline, adapted to salt concentrations from 50 mM NaCl to almost 5.5 M NaCl.

Explanation:

By nitrogen fixation is meant the combination of molecular nitrogen or dinitrogen with oxygen or hydrogen to give oxides or ammonia that can be incorporated into the biosphere. Molecular nitrogen, which is the majority component of the atmosphere, is inert and not directly usable by most living things. Nitrogen fixation can occur abiotic (without the intervention of living beings) or by the action of microorganisms (biological nitrogen fixation). Fixation in general involves the incorporation into the biosphere of a significant amount of nitrogen, which globally can reach about 250 million tons per year, of which 150 correspond to biological fixation.

You might be interested in
The vertical drop of a stream channel over a certain distance is called the _____.
irinina [24]
Gradient should be in the blank, hope that helps
6 0
3 years ago
Read 2 more answers
Helppppppp plz thx........
8090 [49]

Answer:

1) aa- affected

2) Aa- unaffected carrier

3) aa- affected

4) aa- affected

5) Aa - unaffected carrier

6) Aa- unaffected carrier

7) aa- affected

8) aa- affected

9) Aa- unaffected carrier

10) aa- affected

11) Aa- unaffected carrier.

This trait is <em>recessive</em>.

The F1 generation has a 50/50 chance of having unaffected offspring.

Explanation:

1) Given

2) Some of the offspring have the trait, and they're not affected, so they have to be a carrier

3) The box is shaded in so they have to have the trait, which means they have to have the same gene pattern as the other affected person (#1)

4) They are also shaded in, so they have to have the trait

5) Since the parents either have the trait or are carriers, if they're not affected they have to be a carrier

6) Same reasoning as #5

7) This is shaded in, the box has to have the trait

8) Shaded in = has the trait/affected

9) Since the parents either have the trait or are carriers, if they're not affected they have to be a carrier

10) Shaded in = has the trait/affected

11) Since the parents either have the trait or are carriers, if they're not affected they have to be a carrier

Since the trait is displayed when the people have two lowercase letters (aa), and people can be unaffected and carriers, (Aa), this trait has to be recessive.

If you make a Punnett Square, you will see that half of the offspring can result in an Aa, while the other half can result in an aa, meaning there's a 50/50 chance of the offspring of the F1 (first) generation will have the trait.

5 0
3 years ago
Read 2 more answers
Which of the following describes a neutral atom of oxygen? A- 6 protons, 6 neutrons, 6 electrons B- 6 protons, 6 neutrons, 8 ele
Over [174]

I think I may be c im not for shore
8 0
3 years ago
Read 2 more answers
What happens to orbital velocity of earth as it gets closer to the sun
natita [175]
It increases.
.
.
.
.
.
.
.
.
.
.
7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • A plant's photoperiod is the amount of time each day that the plant receives sunlight. A plant with a 12L:12D photoperiod receiv
    5·1 answer
  • Which process requires the participation of all three types of rna?
    12·2 answers
  • What is a relatively dense aggregation of fishes, squid, and other mesopelagic organisms capable of reflecting a sonar pulse tha
    15·1 answer
  • Dalton’s atomic theory stated that every element was made of atoms that could not be subdivided, atoms of the same element are a
    14·2 answers
  • Why do scientists share the results of experiments?
    14·2 answers
  • A student is studying plant cells under a microscope. She observes one set of
    12·1 answer
  • Why are enzymes considered catalysts
    8·1 answer
  • Whats the flow of energy to killer whales in this image
    5·2 answers
  • A lizard lays an egg for a new baby lizard.<br><br> Asexual reproduction<br><br> Sexual reproduction
    6·1 answer
  • Mmmmmmmmmmmmmmmmmmmmm
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!