1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
3 years ago
14

The table below shows the average yearly temp at Ute in four locations near an ocean.

Biology
1 answer:
Xelga [282]3 years ago
4 0
/D/ if not might be B
You might be interested in
Which organisms evolved from the common ancestor Pakicetus?
pav-90 [236]
Hippos likely evolved from a group of anthracotheres about 15 million years ago, the first whales evolved over 50 million years ago, and the ancestor of both these groups was terrestrial. These first whales, such as Pakicetus, were typical land animals. They had long skulls and large carnivorous teeth. Hope I’ve helped ;)
8 0
3 years ago
Read 2 more answers
Eric is studying primary growth in plant roots. Which part of the plant root should he observe
soldier1979 [14.2K]
It enables photosynthesis by facilitating primary growth of the plant
8 0
3 years ago
The maternal effect Drosophila mutation bicoid (bcd
fredd [130]

Answer:

I need the points :((((((

7 0
3 years ago
3. (b) How does crossing over increase the variation in the gametes (and hence the offspring)?
sasho [114]

Answer:

During crossing over, part of one chromosome is exchanged with another. The result is a hybrid chromosome with a unique pattern of genetic material. Gametes gain the ability to be genetically different from their neighboring gametes after crossing over occurs.

3 0
2 years ago
If phillipe have a project but his baby brother eats what should Phillipe do?
Naddika [18.5K]

Answer:

what please explain

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • Explain how enzymes function as biological catalysts in chemical reactions.
    9·1 answer
  • How does the mass of Venus compare to the mass of the Earth?<br>(Give Me A Paragraph)
    15·1 answer
  • Marble is a _____ metamorphic rock. banded foliated nonfoliated folded
    13·2 answers
  • What is gene and what is its function in body?
    7·1 answer
  • 3. It is a situation where a communication takes place.​
    6·2 answers
  • How old was Evelyn when she went to the Royal Academy of Music<br>​​
    9·2 answers
  • What part of the bacteriophage attaches and anchors itself to the bacteria?
    14·1 answer
  • The graph below shows changes in the populations of two species that interact only with each other over a period of time.
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which of the following is NOT one of the key characteristics of a well-designed test?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!