What are you asking I would love to help
<span>The cell has 1% concentration of the salt. The external environment is highly concentrated with 25% saline solution. This will lead to release of water outside the cell, by passive diffusion from a region of high conentration of solvent to lower concentration. Thus, the cell will shrink.</span>
Answer:
<h2>
Interphase : divided into three phases, i) G1 phase, ii) S phase and iii) G2 phase.</h2><h2>Mitotic phase: i) prophase, ii) metaphase, iii) anaphase and v) telophase.</h2>
Explanation:
interphase : divided into three phases, i) G1 phase, ii) S phase and iii) G2 phase.
G1 phase: cell decide whether to divide or not and prepare itself for replication of DNA and arrange replication machinery. otherwise it goes to G 0 phase.
S phase: DNA replication occurs in this phase.
G2 phase: cell duplicates all their contents and prepares for mitotic phase.
Mitotic phase:
i) prophase- chromosome condensation occurs,
ii) metaphase - chromosome arranges in meta-plate and spindle binds to each chromosomes at centromere.
iii) anaphase- chromosome separates from sister chromatids.
iv) telophase- chromosome moves to each ends and formation of nuclear membrane begins.
cytokinesis: there is division of cytoplasm and forming two daughter cells.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
